Construct: shRNA TRCN0000072178

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_438s1c1
DNA Barcode:
CAACAGCCACAACGTCTATAT

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 438 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072178)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 438 13.200 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 438 13.200 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 438 13.200 N/A
4 human 10914 PAPOLA poly(A) polymerase alpha NM_001252007.1 90% 3UTR 1743 N/A N/A
5 mouse 30046 Zfp292 zinc finger protein 292 NM_013889.2 85% CDS 4290 N/A N/A
6 mouse 30046 Zfp292 zinc finger protein 292 XM_006537977.2 85% CDS 907 N/A N/A
7 mouse 30046 Zfp292 zinc finger protein 292 XM_006537978.3 85% 3UTR 6177 N/A N/A
8 mouse 102636861 Gm33814 predicted gene, 33814 XR_376672.3 89% 3UTR 1952 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAACAGCCACAACGTCTATAT
Hairpin Sequence:
5'-CCGG-CAACAGCCACAACGTCTATAT-CTCGAG-ATATAGACGTTGTGGCTGTTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAACAGCCACAACGTCTATATCTCGAGATATAGACGTTGTGGCTGTTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAACAGCCACAACGTCTATATCTCGAGATATAGACGTTGTGGCTGTTG-3'

Other clones with same target sequence:

  1. TRCN0000231750