Construct: shRNA TRCN0000072185

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_436s1c1
DNA Barcode:
TACAACAGCCACAACGTCTAT

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 436 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072185)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 436 4.950 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 95% CDS 436 N/A N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 436 4.950 N/A
4 human 5794 PTPRH protein tyrosine phosphatas... NM_001161440.2 85% CDS 307 N/A N/A
5 human 5794 PTPRH protein tyrosine phosphatas... NM_002842.4 85% CDS 307 N/A N/A
6 human 5794 PTPRH protein tyrosine phosphatas... XM_011527183.1 85% CDS 328 N/A N/A
7 human 5794 PTPRH protein tyrosine phosphatas... XM_011527188.1 85% 5UTR 277 N/A N/A
8 human 5794 PTPRH protein tyrosine phosphatas... XM_011527190.1 85% CDS 328 N/A N/A
9 human 5794 PTPRH protein tyrosine phosphatas... XM_017027056.1 85% CDS 315 N/A N/A
10 human 5794 PTPRH protein tyrosine phosphatas... XM_017027057.1 85% CDS 315 N/A N/A
11 human 5794 PTPRH protein tyrosine phosphatas... XM_017027058.1 85% CDS 348 N/A N/A
12 human 5794 PTPRH protein tyrosine phosphatas... XM_017027059.1 85% CDS 315 N/A N/A
13 human 5794 PTPRH protein tyrosine phosphatas... XM_017027060.1 85% CDS 315 N/A N/A
14 human 5794 PTPRH protein tyrosine phosphatas... XM_017027061.1 85% CDS 315 N/A N/A
15 human 5794 PTPRH protein tyrosine phosphatas... XM_017027062.1 85% 5UTR 223 N/A N/A
16 human 5794 PTPRH protein tyrosine phosphatas... XM_017027063.1 85% 5UTR 216 N/A N/A
17 human 5794 PTPRH protein tyrosine phosphatas... XM_017027064.1 85% CDS 315 N/A N/A
18 human 5794 PTPRH protein tyrosine phosphatas... XR_001753730.1 85% 3UTR 315 N/A N/A
19 human 5794 PTPRH protein tyrosine phosphatas... XR_001753731.1 85% 3UTR 315 N/A N/A
20 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_001142593.2 89% CDS 857 N/A N/A
21 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_001142594.2 89% CDS 978 N/A N/A
22 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_014216.5 89% CDS 978 N/A N/A
23 human 3705 ITPK1 inositol-tetrakisphosphate ... XM_017021262.1 89% CDS 889 N/A N/A
24 human 3705 ITPK1 inositol-tetrakisphosphate ... XM_017021263.1 89% CDS 615 N/A N/A
25 human 3705 ITPK1 inositol-tetrakisphosphate ... XM_017021264.1 89% CDS 687 N/A N/A
26 human 24137 KIF4A kinesin family member 4A NM_012310.4 89% CDS 1216 N/A N/A
27 human 219285 SAMD9L sterile alpha motif domain ... NM_001303496.1 85% 3UTR 6817 N/A N/A
28 human 219285 SAMD9L sterile alpha motif domain ... NM_001303497.1 85% 3UTR 6646 N/A N/A
29 human 219285 SAMD9L sterile alpha motif domain ... NM_001303498.1 85% 3UTR 6382 N/A N/A
30 human 219285 SAMD9L sterile alpha motif domain ... NM_001303500.1 85% 3UTR 6250 N/A N/A
31 human 219285 SAMD9L sterile alpha motif domain ... NM_152703.3 85% 3UTR 7022 N/A N/A
32 human 219285 SAMD9L sterile alpha motif domain ... XM_005250193.3 85% 3UTR 6454 N/A N/A
33 human 219285 SAMD9L sterile alpha motif domain ... XM_006715890.1 85% 3UTR 5823 N/A N/A
34 human 219285 SAMD9L sterile alpha motif domain ... XM_011515903.2 85% 3UTR 6707 N/A N/A
35 human 219285 SAMD9L sterile alpha motif domain ... XM_017011822.1 85% 3UTR 6771 N/A N/A
36 human 219285 SAMD9L sterile alpha motif domain ... XM_017011823.1 85% 3UTR 6527 N/A N/A
37 human 352954 GATS GATS, stromal antigen 3 opp... NR_028038.1 89% 3UTR 3338 N/A N/A
38 human 352954 GATS GATS, stromal antigen 3 opp... XM_017012153.1 89% 3UTR 4181 N/A N/A
39 human 352954 GATS GATS, stromal antigen 3 opp... XR_001744711.1 89% 3UTR 3404 N/A N/A
40 human 285643 KIF4B kinesin family member 4B NM_001099293.1 89% CDS 1233 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TACAACAGCCACAACGTCTAT
Hairpin Sequence:
5'-CCGG-TACAACAGCCACAACGTCTAT-CTCGAG-ATAGACGTTGTGGCTGTTGTA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTA-3'

Other clones with same target sequence:

  1. TRCN0000231747