Construct: shRNA TRCN0000072187

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_692s1c1
DNA Barcode:
CTCTCGGCATGGACGAGCTGT

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 692 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072187)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 692 0.000 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 692 0.000 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 692 0.000 N/A
4 human 157697 ERICH1 glutamate rich 1 XM_017013125.1 85% 3UTR 2686 N/A N/A
5 human 102723347 LOC102723347 uncharacterized LOC102723347 XR_001756163.1 89% 3UTR 1038 N/A N/A
6 human 101928669 LOC101928669 uncharacterized LOC101928669 XR_001756115.1 89% 3UTR 1124 N/A N/A
7 human 101930100 LOC101930100 uncharacterized LOC101930100 XR_001736255.1 89% 3UTR 924 N/A N/A
8 human 101930100 LOC101930100 uncharacterized LOC101930100 XR_001736258.1 89% 3UTR 1331 N/A N/A
9 human 101930100 LOC101930100 uncharacterized LOC101930100 XR_001754944.1 89% 3UTR 1511 N/A N/A
10 human 101930100 LOC101930100 uncharacterized LOC101930100 XR_001754947.1 89% 3UTR 924 N/A N/A
11 human 105379566 LOC105379566 uncharacterized LOC105379566 XR_951451.2 89% 3UTR 1173 N/A N/A
12 mouse 15370 Nr4a1 nuclear receptor subfamily ... NM_010444.2 85% CDS 642 N/A N/A
13 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520455.1 85% CDS 687 N/A N/A
14 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520456.1 85% CDS 774 N/A N/A
15 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520458.1 85% CDS 959 N/A N/A
16 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520459.3 85% CDS 1622 N/A N/A
17 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_017316436.1 85% CDS 1507 N/A N/A
18 mouse 94181 Nans N-acetylneuraminic acid syn... NM_053179.3 89% CDS 363 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTCTCGGCATGGACGAGCTGT
Hairpin Sequence:
5'-CCGG-CTCTCGGCATGGACGAGCTGT-CTCGAG-ACAGCTCGTCCATGCCGAGAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTCTCGGCATGGACGAGCTGTCTCGAGACAGCTCGTCCATGCCGAGAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTCTCGGCATGGACGAGCTGTCTCGAGACAGCTCGTCCATGCCGAGAG-3'

Other clones with same target sequence:

  1. TRCN0000231764