Construct: shRNA TRCN0000072197

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_117s1c1
DNA Barcode:
CTACGGCAAGCTGACCCTGAA

Original Target:

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 117 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072197)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 117 1.350 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 117 1.350 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 117 1.350 N/A
4 human 4914 NTRK1 neurotrophic receptor tyros... NM_001007792.1 89% CDS 2138 N/A N/A
5 human 4914 NTRK1 neurotrophic receptor tyros... NM_001012331.1 89% CDS 2204 N/A N/A
6 human 4914 NTRK1 neurotrophic receptor tyros... NM_002529.3 89% CDS 2222 N/A N/A
7 human 3204 HOXA7 homeobox A7 NM_006896.3 89% CDS 360 N/A N/A
8 human 23413 NCS1 neuronal calcium sensor 1 NM_001128826.1 89% CDS 435 N/A N/A
9 human 23413 NCS1 neuronal calcium sensor 1 NM_014286.3 89% CDS 566 N/A N/A
10 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_001011649.2 85% CDS 5306 N/A N/A
11 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_001272039.1 85% CDS 4853 N/A N/A
12 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_018249.5 85% CDS 5543 N/A N/A
13 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073554.1 85% 3UTR 5618 N/A N/A
14 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073555.1 85% 3UTR 5541 N/A N/A
15 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073556.1 85% 3UTR 5750 N/A N/A
16 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073557.1 85% 3UTR 5623 N/A N/A
17 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073558.1 85% 3UTR 5620 N/A N/A
18 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717182.1 85% CDS 5436 N/A N/A
19 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717185.1 85% CDS 4845 N/A N/A
20 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_011518860.1 85% CDS 5529 N/A N/A
21 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_017014921.1 85% CDS 5433 N/A N/A
22 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_017014922.1 85% CDS 4761 N/A N/A
23 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_017014923.1 85% CDS 4608 N/A N/A
24 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_017014924.1 85% CDS 4280 N/A N/A
25 human 100287036 LOC100287036 uncharacterized LOC100287036 NM_001242885.1 95% 5UTR 86 N/A N/A
26 human 102723313 LOC102723313 uncharacterized LOC102723313 XR_001745803.1 89% 3UTR 3242 N/A N/A
27 human 102723313 LOC102723313 uncharacterized LOC102723313 XR_001745804.1 89% 3UTR 2036 N/A N/A
28 human 102723313 LOC102723313 uncharacterized LOC102723313 XR_001758885.1 89% 3UTR 3242 N/A N/A
29 human 102723313 LOC102723313 uncharacterized LOC102723313 XR_001758886.1 89% 3UTR 2036 N/A N/A
30 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... NM_001025074.2 89% CDS 2902 N/A N/A
31 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... NM_001282961.1 89% CDS 2869 N/A N/A
32 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... XM_006517149.3 89% CDS 2723 N/A N/A
33 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... XM_017315419.1 89% CDS 2894 N/A N/A
34 mouse 105244919 Gm40441 predicted gene, 40441 XR_872820.1 89% 3UTR 146 N/A N/A
35 mouse 108167468 LOC108167468 uncharacterized LOC108167468 XR_001778320.1 89% 3UTR 4527 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACGGCAAGCTGACCCTGAA
Hairpin Sequence:
5'-CCGG-CTACGGCAAGCTGACCCTGAA-CTCGAG-TTCAGGGTCAGCTTGCCGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAG-3'

Other clones with same target sequence:

  1. TRCN0000231757