Construct: shRNA TRCN0000072215

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_403s1c1
DNA Barcode:
GTAATGCAGAAGAAGACCATG

Original Target:

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 403 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072215)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 403 4.050 N/A
2 human 26273 FBXO3 F-box protein 3 XM_011519980.1 89% CDS 1357 N/A N/A
3 human 26273 FBXO3 F-box protein 3 XM_011519982.1 89% CDS 1411 N/A N/A
4 human 81609 SNX27 sorting nexin family member 27 NM_001330723.1 85% 3UTR 3457 N/A N/A
5 human 81609 SNX27 sorting nexin family member 27 XM_017002417.1 85% 3UTR 3935 N/A N/A
6 human 55815 TSNAXIP1 translin associated factor ... NM_001288990.1 89% CDS 1218 N/A N/A
7 human 55815 TSNAXIP1 translin associated factor ... NM_001288991.1 89% CDS 1011 N/A N/A
8 human 55815 TSNAXIP1 translin associated factor ... NM_001288992.1 89% 5UTR 884 N/A N/A
9 human 55815 TSNAXIP1 translin associated factor ... NM_001288993.1 89% 5UTR 1011 N/A N/A
10 human 55815 TSNAXIP1 translin associated factor ... NM_001288994.1 89% 5UTR 687 N/A N/A
11 human 55815 TSNAXIP1 translin associated factor ... NM_018430.3 89% CDS 1407 N/A N/A
12 human 55815 TSNAXIP1 translin associated factor ... XM_005256049.4 89% CDS 1523 N/A N/A
13 human 55815 TSNAXIP1 translin associated factor ... XM_011523230.2 89% CDS 1523 N/A N/A
14 human 55815 TSNAXIP1 translin associated factor ... XM_011523231.2 89% CDS 1523 N/A N/A
15 human 55815 TSNAXIP1 translin associated factor ... XM_011523232.2 89% CDS 1523 N/A N/A
16 human 55815 TSNAXIP1 translin associated factor ... XM_011523233.2 89% CDS 1523 N/A N/A
17 human 55815 TSNAXIP1 translin associated factor ... XM_011523234.2 89% CDS 1523 N/A N/A
18 human 55815 TSNAXIP1 translin associated factor ... XM_011523235.1 89% CDS 1158 N/A N/A
19 human 55815 TSNAXIP1 translin associated factor ... XM_011523236.2 89% CDS 781 N/A N/A
20 human 55815 TSNAXIP1 translin associated factor ... XM_011523237.2 89% CDS 1283 N/A N/A
21 human 55815 TSNAXIP1 translin associated factor ... XM_011523238.1 89% CDS 696 N/A N/A
22 human 55815 TSNAXIP1 translin associated factor ... XM_011523239.1 89% CDS 697 N/A N/A
23 human 55815 TSNAXIP1 translin associated factor ... XM_011523240.1 89% CDS 883 N/A N/A
24 human 55815 TSNAXIP1 translin associated factor ... XM_011523241.1 89% CDS 971 N/A N/A
25 human 55815 TSNAXIP1 translin associated factor ... XM_011523242.1 89% CDS 824 N/A N/A
26 human 55815 TSNAXIP1 translin associated factor ... XM_011523243.1 89% CDS 778 N/A N/A
27 human 55815 TSNAXIP1 translin associated factor ... XM_017023445.1 89% CDS 781 N/A N/A
28 human 55815 TSNAXIP1 translin associated factor ... XM_017023446.1 89% CDS 696 N/A N/A
29 human 55815 TSNAXIP1 translin associated factor ... XM_017023447.1 89% CDS 781 N/A N/A
30 human 55815 TSNAXIP1 translin associated factor ... XM_017023448.1 89% CDS 696 N/A N/A
31 human 55815 TSNAXIP1 translin associated factor ... XM_017023449.1 89% CDS 781 N/A N/A
32 human 55815 TSNAXIP1 translin associated factor ... XM_017023450.1 89% CDS 883 N/A N/A
33 human 55815 TSNAXIP1 translin associated factor ... XM_017023451.1 89% CDS 1069 N/A N/A
34 human 55815 TSNAXIP1 translin associated factor ... XM_017023452.1 89% CDS 824 N/A N/A
35 human 55815 TSNAXIP1 translin associated factor ... XM_017023453.1 89% CDS 971 N/A N/A
36 human 55815 TSNAXIP1 translin associated factor ... XM_017023454.1 89% CDS 824 N/A N/A
37 human 55815 TSNAXIP1 translin associated factor ... XM_017023455.1 89% CDS 824 N/A N/A
38 human 107987190 LOC107987190 uncharacterized LOC107987190 XR_001750010.1 85% 3UTR 116 N/A N/A
39 mouse 215446 Entpd3 ectonucleoside triphosphate... NM_178676.4 86% 3UTR 1964 N/A N/A
40 mouse 554327 2610042L04Rik RIKEN cDNA 2610042L04 gene XM_017316089.1 89% CDS 695 N/A N/A
41 mouse 623078 Gm8108 predicted gene 8108 XR_383051.1 89% 3UTR 459 N/A N/A
42 mouse 100038847 Gm10406 predicted gene 10406 XM_017315702.1 89% CDS 2049 N/A N/A
43 mouse 100040870 Gm3005 predicted gene 3005 XM_006518262.3 89% CDS 617 N/A N/A
44 mouse 100042054 Gm3194 predicted gene 3194 XR_874114.1 89% 3UTR 333 N/A N/A
45 mouse 100042054 Gm3194 predicted gene 3194 XR_874115.1 89% 3UTR 339 N/A N/A
46 mouse 100042304 Gm38418 predicted gene, 38418 XM_011244842.2 89% CDS 626 N/A N/A
47 mouse 100036568 Gm3373 predicted gene 3373 XR_874099.1 89% 3UTR 572 N/A N/A
48 mouse 100036569 Gm16525 predicted gene, 16525 XR_382980.3 89% 3UTR 1341 N/A N/A
49 mouse 100039441 Gm2237 predicted gene 2237 XM_017316234.1 89% 3UTR 657 N/A N/A
50 mouse 100039441 Gm2237 predicted gene 2237 XM_017316239.1 89% CDS 877 N/A N/A
51 mouse 100041012 Gm3095 predicted gene 3095 XR_874079.2 89% 3UTR 414 N/A N/A
52 mouse 100041279 Gm3248 predicted gene 3248 XR_874204.2 89% 3UTR 422 N/A N/A
53 mouse 100041306 Gm3264 predicted gene 3264 XR_874017.2 89% 3UTR 2615 N/A N/A
54 mouse 100041306 Gm3264 predicted gene 3264 XR_874019.2 89% 3UTR 330 N/A N/A
55 mouse 100041678 Gm3500 predicted gene 3500 XM_017315728.1 89% CDS 605 N/A N/A
56 mouse 100042100 Gm3667 predicted gene 3667 XM_017316317.1 89% CDS 1845 N/A N/A
57 mouse 100169868 Gm3173 predicted gene 3173 XM_011244775.1 89% CDS 623 N/A N/A
58 mouse 101055754 LOC101055754 uncharacterized LOC101055754 XM_011244778.1 89% CDS 1313 N/A N/A
59 mouse 102640268 Gm2956 predicted gene 2956 XM_006517861.3 89% CDS 941 N/A N/A
60 mouse 105242418 Gm38690 predicted gene, 38690 XM_017316345.1 89% CDS 382 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTAATGCAGAAGAAGACCATG
Hairpin Sequence:
5'-CCGG-GTAATGCAGAAGAAGACCATG-CTCGAG-CATGGTCTTCTTCTGCATTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTAC-3'

Other clones with same target sequence:

  1. TRCN0000231696