Construct: shRNA TRCN0000207065

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_647s1c1
DNA Barcode:
GCGATCACATGGTCCTGCTGG

Original Target:

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 647 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000207065)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 647 0.000 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 647 0.000 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 647 0.000 N/A
4 human 3340 NDST1 N-deacetylase and N-sulfotr... XM_017009427.1 85% 5UTR 2761 N/A N/A
5 human 79770 TXNDC15 thioredoxin domain containi... NM_024715.3 89% CDS 921 N/A N/A
6 human 378108 TRIM74 tripartite motif containing 74 XR_001744733.1 85% 3UTR 939 N/A N/A
7 human 9572 NR1D1 nuclear receptor subfamily ... NM_021724.4 90% 5UTR 19 N/A N/A
8 human 101930072 FP248 Putative chemokine-related ... XR_957659.2 85% 3UTR 2249 N/A N/A
9 mouse 258482 Olfr266 olfactory receptor 266 NM_146489.1 90% CDS 478 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGATCACATGGTCCTGCTGG
Hairpin Sequence:
5'-CCGG-GCGATCACATGGTCCTGCTGG-CTCGAG-CCAGCAGGACCATGTGATCGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGATCACATGGTCCTGCTGGCTCGAGCCAGCAGGACCATGTGATCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGATCACATGGTCCTGCTGGCTCGAGCCAGCAGGACCATGTGATCGC-3'

Other clones with same target sequence:

(none)