Construct: shRNA TRCN0000222796

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-523s1c1
DNA Barcode:
TCCGTGGTGGACAGCCACATG

Original Target:

Original Target:

Taxon:
Control
Gene:
tGFP (tGFP)
Gene Description:
turboGfp
Transcript:
Broad turboGfp.1 (CURRENT)
Match location:
Position 523 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000222796)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL tGFP tGFP turboGfp turboGfp.1 100% CDS 523 0.000 N/A
2 human 1014 CDH16 cadherin 16 NM_001204744.1 89% CDS 2355 N/A N/A
3 human 1014 CDH16 cadherin 16 NM_001204745.1 89% CDS 2304 N/A N/A
4 human 1014 CDH16 cadherin 16 NM_001204746.1 89% CDS 2130 N/A N/A
5 human 1014 CDH16 cadherin 16 NM_004062.3 89% CDS 2421 N/A N/A
6 human 1014 CDH16 cadherin 16 XM_005255770.2 89% CDS 2312 N/A N/A
7 human 1014 CDH16 cadherin 16 XM_011522807.1 89% CDS 2102 N/A N/A
8 human 2936 GSR glutathione-disulfide reduc... NM_000637.3 89% CDS 405 N/A N/A
9 human 2936 GSR glutathione-disulfide reduc... NM_001195102.1 89% CDS 405 N/A N/A
10 human 2936 GSR glutathione-disulfide reduc... NM_001195103.1 89% CDS 405 N/A N/A
11 human 2936 GSR glutathione-disulfide reduc... NM_001195104.1 89% CDS 405 N/A N/A
12 human 54059 YBEY ybeY metallopeptidase (puta... XM_017028395.1 89% 5UTR 197 N/A N/A
13 human 54059 YBEY ybeY metallopeptidase (puta... XM_017028396.1 89% 3UTR 1933 N/A N/A
14 human 101927764 LOC101927764 uncharacterized LOC101927764 XR_001739673.1 81% 3UTR 2265 N/A N/A
15 human 101927764 LOC101927764 uncharacterized LOC101927764 XR_001743390.1 81% 3UTR 2265 N/A N/A
16 mouse 14917 Gucy2c guanylate cyclase 2c NM_001127318.1 89% CDS 1994 N/A N/A
17 mouse 14917 Gucy2c guanylate cyclase 2c NM_145067.3 89% CDS 1922 N/A N/A
18 mouse 14598 Ggt1 gamma-glutamyltransferase 1 NM_001305992.1 81% CDS 438 N/A N/A
19 mouse 14598 Ggt1 gamma-glutamyltransferase 1 NM_008116.3 81% CDS 442 N/A N/A
20 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_006513230.3 81% CDS 554 N/A N/A
21 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_006513231.3 81% CDS 551 N/A N/A
22 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_011243371.2 81% CDS 559 N/A N/A
23 mouse 240672 Dusp5 dual specificity phosphatase 5 NM_001085390.1 89% CDS 685 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCCGTGGTGGACAGCCACATG
Hairpin Sequence:
5'-CCGG-TCCGTGGTGGACAGCCACATG-CTCGAG-CATGTGGCTGTCCACCACGGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGA-3'

Other clones with same target sequence:

(none)