Construct: shRNA TRCN0000222819

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-510s1c1
DNA Barcode:
CGGCTACTACAGCTCCGTGGT

Original Target:

Taxon:
Control
Gene:
tGFP (tGFP)
Gene Description:
turboGfp
Transcript:
Broad turboGfp.1 (CURRENT)
Match location:
Position 510 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000222819)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL tGFP tGFP turboGfp turboGfp.1 100% CDS 510 0.000 N/A
2 human 57521 RPTOR regulatory associated prote... NM_001163034.1 89% CDS 4294 N/A N/A
3 human 57521 RPTOR regulatory associated prote... NM_020761.2 89% CDS 4768 N/A N/A
4 human 3239 HOXD13 homeobox D13 NM_000523.3 90% CDS 486 N/A N/A
5 human 9719 ADAMTSL2 ADAMTS like 2 NM_001145320.1 89% CDS 2522 N/A N/A
6 human 9719 ADAMTSL2 ADAMTS like 2 NM_014694.3 89% CDS 2180 N/A N/A
7 human 9719 ADAMTSL2 ADAMTS like 2 XM_005272237.3 89% CDS 2377 N/A N/A
8 human 9719 ADAMTSL2 ADAMTS like 2 XM_005272238.3 89% CDS 2019 N/A N/A
9 human 9719 ADAMTSL2 ADAMTS like 2 XM_005272239.2 89% CDS 2055 N/A N/A
10 human 9719 ADAMTSL2 ADAMTS like 2 XM_011519241.2 89% CDS 2198 N/A N/A
11 human 9719 ADAMTSL2 ADAMTS like 2 XM_011519242.2 89% CDS 2054 N/A N/A
12 human 339855 KY kyphoscoliosis peptidase NM_178554.4 89% 3UTR 3450 N/A N/A
13 human 339855 KY kyphoscoliosis peptidase XM_005247418.3 89% 3UTR 8418 N/A N/A
14 human 339855 KY kyphoscoliosis peptidase XM_006713612.3 89% 3UTR 8364 N/A N/A
15 human 339855 KY kyphoscoliosis peptidase XM_017006287.1 89% 3UTR 8496 N/A N/A
16 human 339855 KY kyphoscoliosis peptidase XM_017006288.1 89% 3UTR 8442 N/A N/A
17 human 339855 KY kyphoscoliosis peptidase XM_017006289.1 89% 3UTR 8433 N/A N/A
18 human 339855 KY kyphoscoliosis peptidase XM_017006290.1 89% 3UTR 8379 N/A N/A
19 human 3083 HGFAC HGF activator NM_001297439.1 89% CDS 1734 N/A N/A
20 human 3083 HGFAC HGF activator NM_001528.3 89% CDS 1713 N/A N/A
21 mouse 117146 Ube3b ubiquitin protein ligase E3B NM_054093.2 89% CDS 2917 N/A N/A
22 mouse 117146 Ube3b ubiquitin protein ligase E3B XM_006530126.2 89% CDS 2799 N/A N/A
23 mouse 117146 Ube3b ubiquitin protein ligase E3B XM_011248161.1 89% CDS 1195 N/A N/A
24 mouse 100041879 Gm3561 predicted gene 3561 XR_001782441.1 89% 3UTR 14 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGCTACTACAGCTCCGTGGT
Hairpin Sequence:
5'-CCGG-CGGCTACTACAGCTCCGTGGT-CTCGAG-ACCACGGAGCTGTAGTAGCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGCTACTACAGCTCCGTGGTCTCGAGACCACGGAGCTGTAGTAGCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGCTACTACAGCTCCGTGGTCTCGAGACCACGGAGCTGTAGTAGCCG-3'

Other clones with same target sequence:

(none)