Construct: shRNA TRCN0000222866

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-531s1c1
DNA Barcode:
GGACAGCCACATGCACTTCAA

Original Target:

Taxon:
Control
Gene:
tGFP (tGFP)
Gene Description:
turboGfp
Transcript:
Broad turboGfp.1 (CURRENT)
Match location:
Position 531 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000222866)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL tGFP tGFP turboGfp turboGfp.1 100% CDS 531 4.950 N/A
2 human 4436 MSH2 mutS homolog 2 XR_001738747.1 89% 3UTR 3121 N/A N/A
3 human 26150 RIBC2 RIB43A domain with coiled-c... XM_011530126.2 85% 5UTR 139 N/A N/A
4 human 169693 TMEM252 transmembrane protein 252 NM_153237.1 95% 3UTR 940 N/A N/A
5 human 55122 AKIRIN2 akirin 2 NM_018064.3 89% CDS 920 N/A N/A
6 human 101060405 LOC101060405 putative RRN3-like protein ... XM_011508577.2 90% 3UTR 1157 N/A N/A
7 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_947598.2 89% 3UTR 1165 N/A N/A
8 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_958305.2 89% 3UTR 1165 N/A N/A
9 mouse 226250 Afap1l2 actin filament associated p... NM_001177796.1 89% CDS 1591 N/A N/A
10 mouse 226250 Afap1l2 actin filament associated p... NM_001177797.1 89% CDS 1537 N/A N/A
11 mouse 226250 Afap1l2 actin filament associated p... NM_146102.2 89% CDS 1643 N/A N/A
12 mouse 226250 Afap1l2 actin filament associated p... XM_006527024.2 89% CDS 1690 N/A N/A
13 mouse 226250 Afap1l2 actin filament associated p... XM_017318168.1 89% CDS 1691 N/A N/A
14 mouse 226250 Afap1l2 actin filament associated p... XM_017318169.1 89% CDS 1637 N/A N/A
15 mouse 226250 Afap1l2 actin filament associated p... XM_017318170.1 89% CDS 1607 N/A N/A
16 mouse 226250 Afap1l2 actin filament associated p... XM_017318171.1 89% CDS 1685 N/A N/A
17 mouse 105245896 Gm41277 predicted gene, 41277 XR_875052.1 89% 3UTR 200 N/A N/A
18 mouse 105245896 Gm41277 predicted gene, 41277 XR_875053.1 89% 3UTR 200 N/A N/A
19 mouse 105245896 Gm41277 predicted gene, 41277 XR_875054.1 89% 3UTR 170 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GGACAGCCACATGCACTTCAA
Hairpin Sequence:
5'-CCGG-GGACAGCCACATGCACTTCAA-CTCGAG-TTGAAGTGCATGTGGCTGTCC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCC-3'

Other clones with same target sequence:

(none)