Construct: shRNA TRCN0000222901

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-406s1c1
DNA Barcode:
ACCGACAAGATCATCCGCAGC

Original Target:

Taxon:
Control
Gene:
tGFP (tGFP)
Gene Description:
turboGfp
Transcript:
Broad turboGfp.1 (CURRENT)
Match location:
Position 406 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000222901)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL tGFP tGFP turboGfp turboGfp.1 100% CDS 406 0.400 N/A
2 human 5580 PRKCD protein kinase C delta NM_001316327.1 89% CDS 787 N/A N/A
3 human 5580 PRKCD protein kinase C delta NM_006254.3 89% CDS 954 N/A N/A
4 human 5580 PRKCD protein kinase C delta NM_212539.1 89% CDS 842 N/A N/A
5 human 5580 PRKCD protein kinase C delta XM_006713257.3 89% CDS 761 N/A N/A
6 human 5580 PRKCD protein kinase C delta XM_006713259.2 89% CDS 1058 N/A N/A
7 human 5580 PRKCD protein kinase C delta XM_017006855.1 89% CDS 639 N/A N/A
8 human 5580 PRKCD protein kinase C delta XM_017006856.1 89% CDS 1213 N/A N/A
9 human 5580 PRKCD protein kinase C delta XR_940474.2 89% 3UTR 620 N/A N/A
10 mouse 20847 Stat2 signal transducer and activ... NM_019963.1 85% CDS 2071 N/A N/A
11 mouse 20847 Stat2 signal transducer and activ... XM_006513433.1 85% CDS 2089 N/A N/A
12 mouse 20847 Stat2 signal transducer and activ... XM_006513435.1 85% CDS 1989 N/A N/A
13 mouse 20847 Stat2 signal transducer and activ... XM_006513436.1 85% 3UTR 2169 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACCGACAAGATCATCCGCAGC
Hairpin Sequence:
5'-CCGG-ACCGACAAGATCATCCGCAGC-CTCGAG-GCTGCGGATGATCTTGTCGGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGT-3'

Other clones with same target sequence:

(none)