Transcript: Mouse NM_001113379.1

Mus musculus leucine rich repeat containing 32 (Lrrc32), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Lrrc32 (434215)
Length:
3817
CDS:
1..1992

Additional Resources:

NCBI RefSeq record:
NM_001113379.1
NBCI Gene record:
Lrrc32 (434215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254503 CGCTTCGTCACCTGGATTTAA pLKO_005 224 CDS 100% 15.000 21.000 N Lrrc32 n/a
2 TRCN0000254505 ATGCCAGCGGTGGAGCAATTA pLKO_005 517 CDS 100% 13.200 9.240 N Lrrc32 n/a
3 TRCN0000254504 GATGCTACTCAGGACCTAATC pLKO_005 1780 CDS 100% 10.800 7.560 N Lrrc32 n/a
4 TRCN0000254507 GTCAGCCAGAGCTTCCGTAAT pLKO_005 3491 3UTR 100% 10.800 7.560 N Lrrc32 n/a
5 TRCN0000254506 TCTCCGTCTCAAGCGCCTTAA pLKO_005 1542 CDS 100% 10.800 7.560 N Lrrc32 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3355 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000189006 GCAGAGGGTTTGCTTTGTGAT pLKO.1 3213 3UTR 100% 4.950 2.970 N OR4X2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.