Construct: sgRNA BRDN0001145278
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- ACTGCATCACATCCAACTGA
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- AK7 (122481)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
---|---|---|---|---|---|---|---|---|---|---|
1 | NC_000014.9 | 14 | 96456441 | + | AK7 | NNNGCATCACATCCAACTGA | NGG | 0 | 1.0 | Tier I |
2 | NC_000011.10 | 11 | 108162140 | + | NPAT | NNNGCATGACATCCAACTGA | NTG | 2 | 0.025 | Tier I |
3 | NC_000015.10 | 15 | 48878230 | - | EID1 | NNNGCATCACATCCATCTGC | NGG | 2 | 0.0 | Tier I |
4 | NC_000010.11 | 10 | 21043228 | + | NEBL | NNNGCTTCACATCCAACAGA | NGG | 2 | 0.4762 | Tier II |
5 | NC_000008.11 | 8 | 99564427 | + | VPS13B | NNNGCAGCACATCCAACTGG | NGG | 2 | 0.4498 | Tier II |
6 | NC_000018.10 | 18 | 62332222 | + | TNFRSF11A | NNNGCATCACATCCCACAGA | NGG | 2 | 0.1818 | Tier II |
7 | NC_000005.10 | 5 | 37713803 | + | WDR70 | NNNGTATCACATCCCACTGA | NGG | 2 | 0.1736 | Tier II |
8 | NC_000008.11 | 8 | 714967 | - | ERICH1 | NNNGCAGCACATCCAACTGA | NAG | 2 | 0.1525 | Tier II |
9 | NC_000011.10 | 11 | 108693411 | - | DDX10 | NNNTCATCACATCAAACTGA | NGG | 2 | 0.1273 | Tier II |
10 | NC_000002.12 | 2 | 29426099 | - | ALK | NNNGCATCACATCCAGCTGT | NGG | 2 | 0.1154 | Tier II |
11 | NC_000023.11 | X | 29951347 | + | IL1RAPL1 | NNNTCATCACTTCCAACTGA | NGG | 2 | 0.1119 | Tier II |
12 | NC_000012.12 | 12 | 25973465 | - | RASSF8 | NNNCCATCACATCCAGCTGA | NGG | 2 | 0.1018 | Tier II |
13 | NC_000012.12 | 12 | 2210378 | - | CACNA1C | NNNTCATCACATCCCACTGA | NGG | 2 | 0.0992 | Tier II |
14 | NC_000016.10 | 16 | 1722241 | - | MAPK8IP3 | NNNGCATCACATGCAACTTA | NGG | 2 | 0.0909 | Tier II |
15 | NC_000003.12 | 3 | 174275585 | - | NLGN1 | NNNGCATCACATACTACTGA | NGG | 2 | 0.0769 | Tier II |
16 | NC_000001.11 | 1 | 229619760 | - | TAF5L | NNNGCATCACATCCAGCTGA | NAG | 2 | 0.0499 | Tier II |
17 | NC_000010.11 | 10 | 16922297 | + | CUBN | NNNGCCTCACATCCAACTGA | NCG | 2 | 0.0487 | Tier II |
18 | NC_000016.10 | 16 | 85800485 | - | COX4I1 | NNNGCATCACATTCAACTGA | NTG | 2 | 0.0273 | Tier II |
19 | NC_000011.10 | 11 | 6264263 | - | CCKBR | NNNGGATCACATCCAACTGA | NTG | 2 | 0.0234 | Tier II |
20 | NC_000003.12 | 3 | 50355961 | + | TMEM115 | NNNGCATCACATCCAAGGGA | NGG | 2 | 0.0196 | Tier II |
21 | NC_000012.12 | 12 | 72589529 | - | TRHDE | NNNGCATCACACCCATCTGA | NGG | 2 | 0.0 | Tier II |
22 | NC_000015.10 | 15 | 48878230 | - | SHC4 | NNNGCATCACATCCATCTGC | NGG | 2 | 0.0 | Tier II |
23 | NC_000003.12 | 3 | 172225532 | + | FNDC3B | NNNGCATCACATTCATCTGA | NGG | 2 | 0.0 | Tier II |
24 | NC_000001.11 | 1 | 99464442 | + | LOC124904580 | NNNGCACTACATCCAACTGA | NGG | 2 | 0.6016 | Tier III |
25 | NC_000010.11 | 10 | 2013439 | - | LINC00700 | NNNGCAGCAGATCCAACTGA | NGG | 2 | 0.2288 | Tier III |
26 | NC_000005.10 | 5 | 129170909 | - | LOC102723654 | NNNGCATCACATCAAACTCA | NGG | 2 | 0.1569 | Tier III |
27 | NC_000006.12 | 6 | 1537511 | + | LOC102723944 | NNNGCATCACATAAAACTGA | NGG | 2 | 0.1346 | Tier III |
28 | NC_000003.12 | 3 | 50355961 | + | LOC127898564 | NNNGCATCACATCCAAGGGA | NGG | 2 | 0.0196 | Tier III |
29 | NC_000003.12 | 3 | 132386887 | - | G2E3P1 | NNNGCAACACATCCAACTGA | NGC | 2 | 0.0194 | Tier III |
30 | NC_000003.12 | 3 | 132386887 | - | LOC124909435 | NNNGCAACACATCCAACTGA | NGC | 2 | 0.0194 | Tier III |
31 | NC_000003.12 | 3 | 172225532 | + | RPS27AP8 | NNNGCATCACATTCATCTGA | NGG | 2 | 0.0 | Tier III |
32 | NC_000001.11 | 1 | 208323835 | - | LOC105372889 | NNNGCATCTCATCCACCTGA | NGG | 2 | 0.0 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
---|---|---|---|---|---|---|---|---|---|---|
1 | NC_000068.7 | 2 | 140329756 | - | Sel1l2 | NNNGTATGACATCCAACTGA | NGG | 2 | 0.4091 | Tier II |
2 | NC_000067.6 | 1 | 89477623 | - | Agap1 | NNNCCAGCACATCCAACTGA | NGG | 2 | 0.3114 | Tier II |
3 | NC_000075.6 | 9 | 94780661 | + | Slc9a9 | NNNGCCTCTCATCCAACTGA | NGG | 2 | 0.2727 | Tier II |
4 | NC_000068.7 | 2 | 71996377 | - | Rapgef4 | NNNGCATCAGATTCAACTGA | NGG | 2 | 0.2722 | Tier II |
5 | NC_000082.6 | 16 | 96307491 | + | B3galt5 | NNNGCATCCCCTCCAACTGA | NGG | 2 | 0.2286 | Tier II |
6 | NC_000079.6 | 13 | 8726000 | - | Adarb2 | NNNGCATCACATCCAACTGG | NTG | 2 | 0.0298 | Tier II |
7 | NC_000068.7 | 2 | 160900349 | + | Lpin3 | NNNGCATCACATTCAACTGA | NTG | 2 | 0.0273 | Tier II |
8 | NC_000076.6 | 10 | 56100584 | - | Msl3l2 | NNNGCATCACATCCAACTCA | NTG | 2 | 0.0175 | Tier II |
9 | NC_000076.6 | 10 | 56100584 | - | Tbc1d32 | NNNGCATCACATCCAACTCA | NTG | 2 | 0.0175 | Tier II |
10 | NC_000069.6 | 3 | 157622124 | + | Ptger3 | NNNGCATCACATGCATCTGA | NGG | 2 | 0.0 | Tier II |
11 | NC_000083.6 | 17 | 45258095 | - | Gm41582 | NNNACATCACATCCAATTGA | NGG | 2 | 0.42 | Tier III |
12 | NC_000076.6 | 10 | 117892704 | + | Gm32605 | NNNGCACCACATCCAACTGT | NGG | 2 | 0.4125 | Tier III |
13 | NC_000070.6 | 4 | 125236906 | + | Gm32611 | NNNGCATCACCTCCAACTGA | NAG | 2 | 0.1037 | Tier III |
14 | NC_000082.6 | 16 | 50527924 | + | G730013B05Rik | NNNACATCACATCCAACTGA | NGA | 2 | 0.0625 | Tier III |
15 | NC_000076.6 | 10 | 56100584 | - | Gm29794 | NNNGCATCACATCCAACTCA | NTG | 2 | 0.0175 | Tier III |