Construct: ORF TRCN0000465210
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009426.1_s317c1
- Derived from:
- ccsbBroadEn_09513
- DNA Barcode:
- GTAGGGTCACACACTAGCGGCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NKAIN4 (128414)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465210
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 128414 | NKAIN4 | sodium/potassium transporti... | NM_152864.4 | 99.8% | 99.5% | 519G>T |
2 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_011528527.2 | 92.9% | 92.3% | (many diffs) |
3 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_005260192.2 | 85.8% | 83% | (many diffs) |
4 | human | 128414 | NKAIN4 | sodium/potassium transporti... | NM_001363747.1 | 70% | 69.7% | 0_1ins186;333G>T |
5 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_017027639.2 | 70% | 69.7% | 0_1ins186;333G>T |
6 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_024451825.1 | 70% | 69.7% | 0_1ins186;333G>T |
7 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_011528528.3 | 65% | 64.4% | (many diffs) |
8 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_011528529.3 | 65% | 64.4% | (many diffs) |
9 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_017027636.2 | 65% | 64.4% | (many diffs) |
10 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_017027637.2 | 65% | 64.4% | (many diffs) |
11 | human | 128414 | NKAIN4 | sodium/potassium transporti... | XM_024451824.1 | 65% | 64.4% | (many diffs) |
12 | human | 128414 | NKAIN4 | sodium/potassium transporti... | NM_001363718.1 | 56% | 53.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 690
- ORF length:
- 624
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ctcctgctcc ggccgctgcg cgctcgtcgt cctctgcgct tttcagctgg 121 tcgccgccct ggagaggcag gtgtttgact tcctgggcta ccagtgggcg cccatcctgg 181 ccaactttgt ccacatcatc atcgtcatcc tgggactctt cggcaccatc cagtaccggc 241 tgcgctatgt catggtgtac acgctgtggg cagccgtctg ggtcacctgg aacgtcttca 301 tcatctgctt ctacctggaa gtcggtggcc tcttaaagga cagcgagcta ctgaccttca 361 gcctctcccg gcatcgctcc tggtggcgtg agcgctggcc aggctgtctg catgaggagg 421 tgccagcagt gggcctcggg gccccccatg gccaggccct ggtgtcaggt gctggctgtg 481 ccctggagcc cagctatgtg gaggccctac acagttgcct gcagatcctg atcgcgcttc 541 tgggctttgt ctgtggctgc caggtggtca gcgtgtttac ggatGAAGAG GACAGCTTTG 601 ATTTCATTGG TGGATTTGAT CCATTTCCTC TCTACCATGT CAATGAAAAG CCATCCAGTC 661 TCTTGTCCAA GCAGGTGTAC TTGCCTGCGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 721 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 781 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGTAGG 841 GTCACACACT AGCGGCTCGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 901 tgaaagatt