Transcript: Human XM_011528527.2

PREDICTED: Homo sapiens sodium/potassium transporting ATPase interacting 4 (NKAIN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKAIN4 (128414)
Length:
1603
CDS:
14..682

Additional Resources:

NCBI RefSeq record:
XM_011528527.2
NBCI Gene record:
NKAIN4 (128414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432422 AGCGTCAAGAGAGTTTGTAAT pLKO_005 1074 3UTR 100% 13.200 18.480 N NKAIN4 n/a
2 TRCN0000439860 GAAGTCGGTGGCCTCTTAAAG pLKO_005 266 CDS 100% 13.200 18.480 N NKAIN4 n/a
3 TRCN0000437644 GCGCTATGTCATGGTGTACAC pLKO_005 190 CDS 100% 4.050 5.670 N NKAIN4 n/a
4 TRCN0000136495 CCTCTCTACCATGTCAATGAA pLKO.1 575 CDS 100% 5.625 3.938 N NKAIN4 n/a
5 TRCN0000436258 TTGAACATGGAGGGTTCCTAA pLKO_005 1345 3UTR 100% 4.950 3.465 N NKAIN4 n/a
6 TRCN0000136207 GAACGTCTTCATCATCTGCTT pLKO.1 238 CDS 100% 2.640 1.848 N NKAIN4 n/a
7 TRCN0000134487 GCTTTGATTTCATTGGTGGAT pLKO.1 543 CDS 100% 2.640 1.584 N NKAIN4 n/a
8 TRCN0000134959 GAGGACAGCTTTGATTTCATT pLKO.1 536 CDS 100% 5.625 2.813 Y NKAIN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09513 pDONR223 100% 92.9% 92.3% None (many diffs) n/a
2 ccsbBroad304_09513 pLX_304 0% 92.9% 92.3% V5 (many diffs) n/a
3 TRCN0000465210 GTAGGGTCACACACTAGCGGCTCG pLX_317 18% 92.9% 92.3% V5 (many diffs) n/a
Download CSV