Construct: ORF TRCN0000465301
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002630.1_s317c1
- Derived from:
- ccsbBroadEn_03310
- DNA Barcode:
- ACAAGGGACTACCACAAAACGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LCMT1 (51451)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465301
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51451 | LCMT1 | leucine carboxyl methyltran... | NM_016309.3 | 100% | 100% | |
2 | human | 51451 | LCMT1 | leucine carboxyl methyltran... | XM_011545864.1 | 89.2% | 80% | (many diffs) |
3 | human | 51451 | LCMT1 | leucine carboxyl methyltran... | NM_001032391.2 | 83.5% | 83.5% | 403_404ins165 |
4 | human | 51451 | LCMT1 | leucine carboxyl methyltran... | XM_011545862.2 | 74% | 65.5% | (many diffs) |
5 | human | 51451 | LCMT1 | leucine carboxyl methyltran... | XM_005255354.4 | 70% | 70% | 0_1ins300 |
6 | mouse | 30949 | Lcmt1 | leucine carboxyl methyltran... | NM_025304.3 | 85.3% | 88.3% | (many diffs) |
7 | mouse | 30949 | Lcmt1 | leucine carboxyl methyltran... | XM_006507917.3 | 45.9% | 48.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1068
- ORF length:
- 1002
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cactaggcag agggaatcct ctatcacctc ctgctgttcc acctcgagct 121 gcgacgcaga cgacgagggc gtgcgcggca cctgcgaaga tgcttccctg tgcaagaggt 181 ttgcagtaag cattggctac tggcatgacc cttacataca gcactttgtg agactgtcta 241 aagagaggaa agcccctgaa atcaacagag gatattttgc tcgagtccat ggtgtcagtc 301 agcttataaa ggcatttcta cggaagacag aatgtcattg tcaaattgtc aaccttgggg 361 caggcatgga taccaccttc tggagattaa aggatgaaga tcttctccca agtaaatatt 421 ttgaggttga ctttccaatg attgtcacga gaaagctgca cagtatcaaa tgcaagcctc 481 ccctatccag ccccattcta gaactgcatt cagaggacac acttcagatg gatggacaca 541 tactggattc aaagagatat gccgttattg gagcagatct ccgagacctg tctgaactgg 601 aagagaagct aaagaaatgt aacatgaata cacaattgcc aacactcctg atagctgaat 661 gtgtgctggt ttacatgact ccagagcagt ccgcaaacct cctgaagtgg gcagccaaca 721 gttttgagag agccatgttc ataaactacg aacaggtgaa catgggtgat cggtttgggc 781 agatcatgat tgaaaacctg cggagacgcc agtgtgacct ggcgggagtg gagacctgca 841 agtcattAGA GTCACAGAAA GAACGGCTCC TGTCGAATGG GTGGGAAACA GCATCGGCCG 901 TCGACATGAT GGAGTTGTAC AACAGGTTAC CTCGAGCTGA AGTGAGCAGG ATAGAATCAC 961 TTGAATTCCT GGATGAAATG GAGCTGCTGG AGCAGCTCAT GCGGCATTAC TGCCTTTGCT 1021 GGGCAACCAA AGGAGGAAAT GAGCTTGGGC TGAAGGAGAT AACTTATTAC CCAACTTTCT 1081 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1141 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1201 GTGGAAAGGA CGAACAAGGG ACTACCACAA AACGTCAACG CGTTAAGTCg acaatcaacc 1261 tctggattac aaaatttgtg aaagatt