Transcript: Mouse NM_025304.3

Mus musculus leucine carboxyl methyltransferase 1 (Lcmt1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lcmt1 (30949)
Length:
1369
CDS:
168..1166

Additional Resources:

NCBI RefSeq record:
NM_025304.3
NBCI Gene record:
Lcmt1 (30949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025304.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184036 CTACTGGCATGATCCGTACAT pLKO.1 293 CDS 100% 4.950 6.930 N Lcmt1 n/a
2 TRCN0000216582 GAAGGTCTTCTCCCAAATAAA pLKO.1 492 CDS 100% 15.000 10.500 N Lcmt1 n/a
3 TRCN0000216581 GGTGTCAGTCAGCTTATTAAA pLKO.1 387 CDS 100% 15.000 10.500 N Lcmt1 n/a
4 TRCN0000246720 TGGTGTCAGTCAGCTTATTAA pLKO_005 386 CDS 100% 15.000 10.500 N Lcmt1 n/a
5 TRCN0000246723 TTGAGACAGCCATGTTCATAA pLKO_005 820 CDS 100% 13.200 9.240 N Lcmt1 n/a
6 TRCN0000180351 GAGCTTGGTTTGAAGGAGATA pLKO.1 1137 CDS 100% 4.950 3.465 N Lcmt1 n/a
7 TRCN0000246721 TACCACCTTCTGGAAATTAAA pLKO_005 467 CDS 100% 0.000 0.000 N Lcmt1 n/a
8 TRCN0000246719 ATGAAGGTCTTCTCCCAAATA pLKO_005 490 CDS 100% 13.200 7.920 N Lcmt1 n/a
9 TRCN0000246722 GAAGGTGAAGGCTCTAGCTAA pLKO_005 1192 3UTR 100% 4.950 2.970 N Lcmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025304.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03310 pDONR223 100% 85.3% 88.3% None (many diffs) n/a
2 ccsbBroad304_03310 pLX_304 0% 85.3% 88.3% V5 (many diffs) n/a
3 TRCN0000465301 ACAAGGGACTACCACAAAACGTCA pLX_317 22.6% 85.3% 88.3% V5 (many diffs) n/a
Download CSV