Construct: ORF TRCN0000465460
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018244.1_s317c1
- Derived from:
- ccsbBroadEn_04257
- DNA Barcode:
- CCATCTGCTCGAATATGACCAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPRY4 (81848)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465460
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | NM_001127496.2 | 100% | 100% | |
2 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | NM_001293289.2 | 100% | 100% | |
3 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | NM_001293290.2 | 100% | 100% | |
4 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | XM_017009910.2 | 100% | 100% | |
5 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | NM_030964.4 | 92.8% | 92.8% | 1_69del |
6 | human | 81848 | SPRY4 | sprouty RTK signaling antag... | XM_011537685.3 | 92.8% | 92.8% | 1_69del |
7 | mouse | 24066 | Spry4 | sprouty homolog 4 (Drosophila) | NM_011898.2 | 88.5% | 92.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 966
- ORF length:
- 897
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagcccccg atcccacaga gcgccccctt gactcccaac tcagtcatgg 121 tccagcccct tcttgacagc cggatgtccc acagccggct ccagcaccca ctcaccatcc 181 tacccattga ccaggtgaag accagccatg tggagaatga ctacatagac aaccctagcc 241 tggccctgac caccggccca aagcggaccc ggggcggggc cccagagctg gccccgacgc 301 ccgcccgctg tgaccaggat gtcacccacc attggatctc cttcagcggg cgccccagct 361 ctgtgagcag cagcagcagc acatcctctg accaacggct cttagaccac atggcaccac 421 cacccgtggc tgaccaggcc tcaccaaggg ctgtgcgcat ccagcccaag gtggtccact 481 gccagccgct ggacctcaag ggcccggcgg tcccacccga gctggacaag cacttcttgc 541 tgtgcgaggc ctgtgggaag tgtaaatgca aggagtgtgc atccccccgg acgttgcctt 601 cctgctgggt ctgcaaccag gagtgcctgt gctcagccca gactctggtc aactatggca 661 cgtgcatgtg tttggtgcag ggcatcttct accactgcac gaatgaggac gatgagggct 721 cctgcgctga ccacccctgc tcctgctccc gctccaactg ctgcgcccgc tggtccttca 781 tgggtgctct ctccgtggtg ctgccctgcc tgctctgcta cctgcctgcc accggctgcg 841 tgaagctggc ccagcgtggc tacgaccgtc TGCGCCGCCC TGGTTGCCGC TGCAAGCACA 901 CGAACAGCGT CATCTGCAAA GCAGCCAGCG GGGATGCCAA GACCAGCAGG CCCGACAAGC 961 CTTTCTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1021 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1081 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCATCTGCT CGAATATGAC CAGGTACGCG 1141 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt