Transcript: Human NM_001293290.2

Homo sapiens sprouty RTK signaling antagonist 4 (SPRY4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SPRY4 (81848)
Length:
5079
CDS:
406..1305

Additional Resources:

NCBI RefSeq record:
NM_001293290.2
NBCI Gene record:
SPRY4 (81848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236353 AGGCCTGTGGGAAGTGTAAAT pLKO_005 884 CDS 100% 13.200 9.240 N SPRY4 n/a
2 TRCN0000236355 CTACCGACAAAGACCCTATTT pLKO_005 3599 3UTR 100% 13.200 9.240 N SPRY4 n/a
3 TRCN0000236352 CCCAGACTCTGGTCAACTATG pLKO_005 974 CDS 100% 10.800 7.560 N SPRY4 n/a
4 TRCN0000056698 CATGTGGAGAATGACTACATA pLKO.1 544 CDS 100% 5.625 3.938 N SPRY4 n/a
5 TRCN0000056699 GCCCAGACTCTGGTCAACTAT pLKO.1 973 CDS 100% 5.625 3.938 N SPRY4 n/a
6 TRCN0000236354 TTCTACCACTGCACGAATGAG pLKO_005 1024 CDS 100% 4.950 3.465 N SPRY4 n/a
7 TRCN0000056701 CCAACGGCTCTTAGACCACAT pLKO.1 729 CDS 100% 4.050 2.835 N SPRY4 n/a
8 TRCN0000056702 CTGTGGGAAGTGTAAATGCAA pLKO.1 888 CDS 100% 3.000 2.100 N SPRY4 n/a
9 TRCN0000236356 ACAAGCCTTTCTGACAGTTTG pLKO_005 1292 CDS 100% 10.800 6.480 N SPRY4 n/a
10 TRCN0000056700 CCTACCCATTGACCAGGTGAA pLKO.1 516 CDS 100% 4.050 2.430 N SPRY4 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3554 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04257 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04257 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465460 CCATCTGCTCGAATATGACCAGGT pLX_317 11.5% 100% 100% V5 n/a
Download CSV