Construct: ORF TRCN0000465486
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014283.1_s317c1
- Derived from:
- ccsbBroadEn_13475
- DNA Barcode:
- CTTCATACGAATATCCAGTACGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCML4 (256380)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465486
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535707.2 | 87.6% | 84.4% | (many diffs) |
| 2 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535703.2 | 77.9% | 76.8% | (many diffs) |
| 3 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535704.2 | 77.9% | 76.8% | (many diffs) |
| 4 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010684.1 | 75% | 71% | (many diffs) |
| 5 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010686.1 | 72.1% | 70.9% | (many diffs) |
| 6 | human | 256380 | SCML4 | Scm polycomb group protein ... | NM_001286408.2 | 70.4% | 69.3% | (many diffs) |
| 7 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535706.1 | 70.4% | 69.3% | (many diffs) |
| 8 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010683.1 | 70.4% | 69.3% | (many diffs) |
| 9 | human | 256380 | SCML4 | Scm polycomb group protein ... | NM_198081.5 | 69.7% | 66.1% | (many diffs) |
| 10 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010678.1 | 69.7% | 66.1% | (many diffs) |
| 11 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010679.1 | 69.7% | 66.1% | (many diffs) |
| 12 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010680.1 | 69.7% | 66.1% | (many diffs) |
| 13 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010681.1 | 69.7% | 66.1% | (many diffs) |
| 14 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010682.2 | 69.7% | 66.1% | (many diffs) |
| 15 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010677.1 | 65.3% | 62% | (many diffs) |
| 16 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010687.1 | 61.4% | 48% | (many diffs) |
| 17 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010688.1 | 53.7% | 49% | (many diffs) |
| 18 | human | 256380 | SCML4 | Scm polycomb group protein ... | XR_001743305.1 | 51.5% | (many diffs) | |
| 19 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_017010685.1 | 50.4% | 47% | (many diffs) |
| 20 | human | 256380 | SCML4 | Scm polycomb group protein ... | NM_001286409.2 | 22.8% | 21.5% | (many diffs) |
| 21 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535709.2 | 22.8% | 21.5% | (many diffs) |
| 22 | human | 256380 | SCML4 | Scm polycomb group protein ... | XM_011535710.2 | 22.8% | 21.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ctgccagaga acagcttgga taggttgcga caggcagaga acccccccat 121 tccactggag agagatcaag tctcgggttc tcatgactcc cttagccctc tcacctccgc 181 ggagtacccc agagcccgac ctcagctcca tccctcagga cgcagccacg gtccccagct 241 tggcggcccc acaggctctc acagtctgcc tctacatcaa caagcaggcc aatgcggggc 301 cctatctgga gaggaagaag gtgcagcagc tcccggagca ttttgggccc gagcggccat 361 cggcggtgct gcagcaggcc gtccaagcct gcatcgactg cgcccaccag cagaagctgg 421 tcttctccct ggtcaagcag ggctatggtg gtgagatggt gtcagtctcg gcttcctttg 481 atggcaaaca gcacctgcgg agcctgcctg tggtgaacag catcggctat gtcctccgct 541 tcctcgccaa gctgtgccga agcctcctgt gcgatgacct cttcagccac cagcccttcc 601 ccaggggctg cagtgccTCT GAGAAAGTCC AGGAGAAAGA GGAAGGGAGG ATGGAATCAG 661 TCAAGACAGT CACCACCGAA GAGTACCTGG TGAACCCTGT GGGCATGAAC CGCTACAGCG 721 TGGACACCTC CGCCTCCACC TTTAACCACA GGGGCTCCTT GCACCCCTCC TCCTCGCTGT 781 ACTGCAAGAG GCAGAACTCT GGAGACAGCC ACCTTGGGGG TGGTCCTGCT GCCACCGCTG 841 GTGGTCCCCG CACTAGCCCC ATGTCTTCTG GTGGCCCCTC GGCACCTGGG CTGAGGCCTC 901 CAGCCTCCAG CCCCAAGAGA AACACGACCT CTCTTGAAGG AAACAGATGT GGTAATGTAA 961 TGCATGCATC AGCTTCCCAC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTTC ATACGAATAT 1141 CCAGTACGGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt