Transcript: Human XM_017010677.1

PREDICTED: Homo sapiens Scm polycomb group protein like 4 (SCML4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCML4 (256380)
Length:
9466
CDS:
235..1563

Additional Resources:

NCBI RefSeq record:
XM_017010677.1
NBCI Gene record:
SCML4 (256380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236318 TGGCAGTTCATAACCTTTATT pLKO_005 386 CDS 100% 15.000 21.000 N SCML4 n/a
2 TRCN0000236320 AGTTGTATCTGTGGCTAATTT pLKO_005 2604 3UTR 100% 15.000 10.500 N SCML4 n/a
3 TRCN0000236317 TGAAACTCTGCTACCACATTG pLKO_005 1517 CDS 100% 10.800 7.560 N SCML4 n/a
4 TRCN0000236321 TGGTGAACAGCATCGGCTATG pLKO_005 851 CDS 100% 6.000 4.200 N SCML4 n/a
5 TRCN0000236319 CACTTCACTCCACGCCTATGA pLKO_005 362 CDS 100% 4.950 3.465 N SCML4 n/a
6 TRCN0000098333 CTCTTCAGAAAGCACGAGATT pLKO.1 1423 CDS 100% 4.950 2.970 N Scml4 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 86 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13475 pDONR223 100% 65.3% 62% None (many diffs) n/a
2 ccsbBroad304_13475 pLX_304 0% 65.3% 62% V5 (many diffs) n/a
3 TRCN0000465486 CTTCATACGAATATCCAGTACGGA pLX_317 40% 65.3% 62% V5 (many diffs) n/a
Download CSV