Construct: ORF TRCN0000465488
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013643.1_s317c1
- Derived from:
- ccsbBroadEn_05737
- DNA Barcode:
- TGCAACCTTCTACTGTCCGTCGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM242 (729515)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465488
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 729515 | TMEM242 | transmembrane protein 242 | NM_018452.6 | 100% | 100% | |
| 2 | mouse | 70544 | Tmem242 | transmembrane protein 242 | NM_027457.4 | 82% | 85.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 489
- ORF length:
- 423
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gacagcgggc gctgcaactg ggcagccggc ctctgggctg gaggctccgg 121 ggtccacgaa tgaccggctt ttcctggtta aaggtggaat tttccttggt accgttgctg 181 cagcgggaat gctagctgga tttattacaa cattatcatt ggctaaaaag aaaagccctg 241 aatggttcaa taagggaagt atggccacgg ctgcattacc ggaaagcggg tcttcccttg 301 ccttgcgagc tctgggctgg ggctccctGT ATGCATGGTG TGGGGTTGGT GTGATTAGCT 361 TCGCAGTCTG GAAAGCTTTA GGAGTTCACA GTATGAACGA CTTTCGAAGT AAAATGCAAT 421 CAATATTTCC AACAATTCCC AAGAACTCCG AATCGGCTGT TGAGTGGGAG GAAACATTGA 481 AATCCAAATG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 541 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 601 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATGCAAC CTTCTACTGT CCGTCGAGAC 661 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt