Transcript: Mouse NM_027457.4

Mus musculus transmembrane protein 242 (Tmem242), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem242 (70544)
Length:
971
CDS:
44..466

Additional Resources:

NCBI RefSeq record:
NM_027457.4
NBCI Gene record:
Tmem242 (70544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191913 GATCGGTTGTTTCTGGTTAAA pLKO.1 107 CDS 100% 13.200 18.480 N Tmem242 n/a
2 TRCN0000191765 GCTGGATTTGTTACAACATTA pLKO.1 170 CDS 100% 13.200 9.240 N Tmem242 n/a
3 TRCN0000200505 CAATCCATATTCCCACCAATT pLKO.1 392 CDS 100% 10.800 7.560 N Tmem242 n/a
4 TRCN0000201021 CCTGGAGGAAATGTTGTTGTT pLKO.1 685 3UTR 100% 4.950 3.465 N Tmem242 n/a
5 TRCN0000192318 CGGTTGTTTCTGGTTAAAGGT pLKO.1 110 CDS 100% 3.000 2.100 N Tmem242 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05737 pDONR223 100% 82% 85.8% None (many diffs) n/a
2 ccsbBroad304_05737 pLX_304 0% 82% 85.8% V5 (many diffs) n/a
3 TRCN0000465488 TGCAACCTTCTACTGTCCGTCGAG pLX_317 38.6% 82% 85.8% V5 (many diffs) n/a
Download CSV