Construct: ORF TRCN0000465515
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013091.2_s317c1
- Derived from:
- ccsbBroadEn_01297
- DNA Barcode:
- GCGGCCCCCGTTGCGTCCTGAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRPS1 (5631)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465515
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_002764.4 | 100% | 100% | |
| 2 | human | 221823 | PRPS1L1 | phosphoribosyl pyrophosphat... | NM_175886.3 | 92.2% | 94% | (many diffs) |
| 3 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_001204402.1 | 35.8% | 35.8% | 0_1ins612 |
| 4 | mouse | 19139 | Prps1 | phosphoribosyl pyrophosphat... | NM_021463.4 | 92.4% | 100% | (many diffs) |
| 5 | mouse | 328099 | Prps1l3 | phosphoribosyl pyrophosphat... | NM_001037746.3 | 92.4% | 99.6% | (many diffs) |
| 6 | mouse | 75456 | Prps1l1 | phosphoribosyl pyrophosphat... | NM_029294.2 | 87.7% | 95.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1020
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gaatatcaaa atcttcagcg gcagctccca ccaggactta tctcagaaaa 121 ttgctgaccg cctgggcctg gagctaggca aggtggtgac taagaaattc agcaaccagg 181 agacctgtgt ggaaattggt gaaagtgtac gtggagagga tgtctacatt gttcagagtg 241 gttgtggcga aatcaatgac aatttaatgg agcttttgat catgattaat gcctgcaaga 301 ttgcttcagc cagccgggtt actgcagtca tcccatgctt cccttatgcc cggcaggata 361 agaaagataa gagccgggcg ccaatctcag ccaagcttgt tgcaaatatg ctatctgtag 421 caggtgcaga tcatattatc accatggacc tacatgcttc tcaaattcag ggcttttttg 481 atatcccagt agacaatttg tatgcagagc cggctgtcct aaagtggata agggagaata 541 tctctgagtg gaggaactgc actattgtct cacctgatgc tggtggagct aagagagtga 601 cctccattgc agacaggctg aatgtggact ttgccttgat tcacaaagaa cggaagaagg 661 ccaatgaagt ggaccgcatg gtgcttgtgg gagatgtgaa ggatcgggtg gccatccttg 721 tggatgacat ggctgacact tgtggcacaa tctgccatgc agctgacaaa cttctctcag 781 ctGGCGCCAC CAGAGTTTAT GCCATCTTGA CTCATGGAAT CTTCTCCGGT CCTGCTATTT 841 CTCGCATCAA CAACGCATGC TTTGAGGCAG TAGTAGTCAC CAATACCATA CCTCAGGAGG 901 ACAAGATGAA GCATTGCTCC AAAATACAGG TGATTGACAT CTCTATGATC CTTGCAGAAG 961 CCATCAGGAG AACTCACAAT GGAGAATCCG TTTCTTACCT ATTCAGCCAT GTCCCTTTAT 1021 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1081 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1141 TTTATATATC TTGTGGAAAG GACGAGCGGC CCCCGTTGCG TCCTGAAAAA CGCGTTAAGT 1201 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt