Transcript: Human NM_002764.4

Homo sapiens phosphoribosyl pyrophosphate synthetase 1 (PRPS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
PRPS1 (5631)
Length:
2070
CDS:
120..1076

Additional Resources:

NCBI RefSeq record:
NM_002764.4
NBCI Gene record:
PRPS1 (5631)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002764.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314632 ACATCCCACATCAGGTATATT pLKO_005 1188 3UTR 100% 15.000 21.000 N PRPS1 n/a
2 TRCN0000356008 GAATCCGTTTCTTACCTATTC pLKO_005 1038 CDS 100% 10.800 15.120 N PRPS1 n/a
3 TRCN0000355958 ATTCTGGCTTCCTTGATAATT pLKO_005 1277 3UTR 100% 15.000 10.500 N PRPS1 n/a
4 TRCN0000367679 GGCGAAATCAATGACAATTTA pLKO_005 300 CDS 100% 15.000 10.500 N PRPS1 n/a
5 TRCN0000010122 CTGCACTATTGTCTCACCTGA pLKO.1 611 CDS 100% 2.640 1.848 N PRPS1 n/a
6 TRCN0000010124 GCGCCACCAGAGTTTATGCCA pLKO.1 838 CDS 100% 0.250 0.175 N PRPS1 n/a
7 TRCN0000314633 TAGCAGGTGCAGATCATATTA pLKO_005 472 CDS 100% 15.000 9.000 N PRPS1 n/a
8 TRCN0000010125 CAGGAGGACAAGATGAAGCAT pLKO.1 948 CDS 100% 3.000 1.800 N PRPS1 n/a
9 TRCN0000314706 CAGGAGGACAAGATGAAGCAT pLKO_005 948 CDS 100% 3.000 1.800 N PRPS1 n/a
10 TRCN0000010123 TGGACTTTGCCTTGATTCACA pLKO.1 679 CDS 100% 3.000 1.800 N PRPS1 n/a
11 TRCN0000314705 TGGACTTTGCCTTGATTCACA pLKO_005 679 CDS 100% 3.000 1.800 N PRPS1 n/a
12 TRCN0000374311 GCAAGGTGGTGACTAAGAAAT pLKO_005 202 CDS 100% 13.200 6.600 Y Prps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002764.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01297 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01297 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465515 GCGGCCCCCGTTGCGTCCTGAAAA pLX_317 25.4% 100% 100% V5 n/a
4 ccsbBroadEn_14815 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14815 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000473409 AGCTTGACGTCGCATAGTTTCCTT pLX_317 40% 100% 100% V5 n/a
7 TRCN0000489690 TGCGCCCAGTGAATATCTAAAAAA pLX_317 45.3% 99.5% 99.3% V5 (not translated due to prior stop codon) 954_954delAinsTTGG n/a
8 TRCN0000469864 TTGTGTCTGGGCTCAGCACACATC pLX_317 37.8% 92.1% 1.5% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_15291 pDONR223 100% 91.9% 1.5% None (many diffs) n/a
10 ccsbBroad304_15291 pLX_304 0% 91.9% 1.5% V5 (not translated due to prior stop codon) (many diffs) n/a
11 ccsbBroadEn_06782 pDONR223 100% 80% 95.2% None (many diffs) n/a
12 TRCN0000466127 ACTCAGTGCCGCACGCAGTATTGT pLX_317 40.1% 80% 95.2% V5 (many diffs) n/a
13 ccsbBroadEn_14816 pDONR223 0% 80% 95.2% None (many diffs) n/a
14 ccsbBroad304_14816 pLX_304 0% 80% 95.2% V5 (many diffs) n/a
15 TRCN0000471920 CGTGGCCTACGACTTCCGGATCCG pLX_317 35.5% 80% 95.2% V5 (many diffs) n/a
16 TRCN0000492233 GTTTTTGGCATTCGTGCCCAATAT pLX_317 43.2% 80% 95.2% V5 (not translated due to prior stop codon) (many diffs) n/a
17 ccsbBroadEn_01299 pDONR223 100% 79.8% 95.2% None (many diffs) n/a
18 ccsbBroad304_01299 pLX_304 0% 79.8% 95.2% V5 (many diffs) n/a
19 TRCN0000475829 AATCCTTTTAGAGGCTTGGACTGC pLX_317 32% 79.8% 95.2% V5 (many diffs) n/a
20 ccsbBroadEn_01298 pDONR223 100% 79.1% 94.3% None (many diffs) n/a
21 ccsbBroad304_01298 pLX_304 0% 79.1% 94.3% V5 (many diffs) n/a
22 TRCN0000474643 CACTTTTGCAGGAATGATATTATT pLX_317 35.3% 79.1% 94.3% V5 (many diffs) n/a
Download CSV