Construct: ORF TRCN0000465643
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002958.1_s317c1
- Derived from:
- ccsbBroadEn_03531
- DNA Barcode:
- AGCTAGGATTAACCCGATAGTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WRAP53 (55135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465643
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55135 | WRAP53 | WD repeat containing antise... | NM_001143990.1 | 100% | 100% | |
2 | human | 55135 | WRAP53 | WD repeat containing antise... | NM_001143991.2 | 100% | 100% | |
3 | human | 55135 | WRAP53 | WD repeat containing antise... | NM_001143992.2 | 100% | 100% | |
4 | human | 55135 | WRAP53 | WD repeat containing antise... | NM_018081.2 | 100% | 100% | |
5 | human | 55135 | WRAP53 | WD repeat containing antise... | XR_001752551.2 | 85% | 1_245del;977_1008del;1922_1933del | |
6 | human | 55135 | WRAP53 | WD repeat containing antise... | XM_011523952.2 | 61.1% | 61.1% | 0_1ins639 |
7 | human | 55135 | WRAP53 | WD repeat containing antise... | XM_024450825.1 | 49.4% | 46.5% | 732_763del;861_862ins815 |
8 | human | 55135 | WRAP53 | WD repeat containing antise... | XM_024450824.1 | 48.9% | 43.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1710
- ORF length:
- 1644
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gactttggag actcaaccgt tagctccgga ctgctgtcct tcagaccagg 121 acccagctcc agcccatcct tctccccacg cttccccgat gaataaaaat gcggactctg 181 aactgatgcc accgcctccc gaaagggggg atccgccccg gttgtcccca gatcctgtgg 241 ctggctcagc tgtgtcccag gagctacggg agggggaccc agtttctctc tccactcccc 301 tggaaacaga gtttggttcc cctagtgagt tgagtcctcg aatcgaggag caagaacttt 361 ctgaaaatac aagccttcct gcagaagaag caaacgggag cctttctgaa gaagaagcga 421 acgggccaga gttggggtct ggaaaagcca tggaagatac ctctggggaa cccgctgcag 481 aggacgaggg agacaccgct tggaactaca gcttctccca gctgcctcga tttctcagtg 541 gttcctggtc agagttcagc acccaacctg agaacttctt gaaaggctgt aagtgggctc 601 ctgacggttc ctgcatcttg accaatagtg ctgataacat cttgcgaatt tataacctgc 661 ccccagagct gtaccatgag ggggagcagg tggaatatgc agaaatggtc cctgtccttc 721 gaatggtgga aggtgatacc atctatgatt actgctggta ttctctgatg tcctcagccc 781 agccagacac ctcctacgtg gccagcagca gccgggagaa cccgattcat atctgggacg 841 cattcactgg agagctccgg gcttcctttc gcgcctacaa ccacctggat gagctgacgg 901 cagcccattc gctctgcttc tccccggatg gctcccagct cttctgtggc ttcaaccgga 961 ctgtgcgtgt tttttccacg gcccggcctg gccgagactg cgaggtccga gccacatttg 1021 caaaaaagca gggccagagc ggcatcatct cctgcatagc cttcagccca gcccagcccc 1081 tctatgcctg tggctcctac ggccgctccc tgggtctgta tgcctgggat gatggctccc 1141 ctctcgcctt gctgggaggg caccaagggg gcatcaccca cctctgcttt catcccgatg 1201 gcaaccgctt cttctcagga gcccgcaagg atgctgagct cctgtgctgg gatctccggc 1261 agtctggtta cccactgtgg tccctgggtc gagaggtgac caccaatcag cgcatctact 1321 tcgatctgga cccgaccggg cagttcctag tgagtggcag cacgagcggg gctgtctctg 1381 tgtgggacac ggacgggcct ggcaatgatg ggaagccgga gcccgtgttg agttttctgc 1441 cccagaagga ctgcaccaat ggcgtgagcc tgcaccctag cctgcctctc ctggccactg 1501 ccTCCGGTCA GCGTGTGTTT CCTGAGCCCA CAGAGAGTGG GGACGAAGGA GAGGAGCTGG 1561 GCCTTCCCTT GCTCTCCACG CGCCACGTCC ACCTTGAATG TCGGCTTCAG CTCTGGTGGT 1621 GTGGGGGGGC GCCAGACTCC AGCATCCCTG ATGATCACCA GGGCGAGAAA GGGCAGGGAG 1681 GAACGGAGGG AGGTGTGGGT GAGCTGATAT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1741 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1801 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAGCTA 1861 GGATTAACCC GATAGTATTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1921 tgaaagatt