Transcript: Human NM_001143992.2

Homo sapiens WD repeat containing antisense to TP53 (WRAP53), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
WRAP53 (55135)
Length:
1749
CDS:
87..1733

Additional Resources:

NCBI RefSeq record:
NM_001143992.2
NBCI Gene record:
WRAP53 (55135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298497 TGATAACATCTTGCGAATTTA pLKO_005 653 CDS 100% 15.000 21.000 N WRAP53 n/a
2 TRCN0000000312 GTTCCTGCATCTTGACCAATA pLKO.1 628 CDS 100% 10.800 8.640 N WRAP53 n/a
3 TRCN0000342432 GTTCCTGCATCTTGACCAATA pLKO_005 628 CDS 100% 10.800 8.640 N WRAP53 n/a
4 TRCN0000000311 TGCCTCGATTTCTCAGTGGTT pLKO.1 544 CDS 100% 2.640 2.112 N WRAP53 n/a
5 TRCN0000216152 CTATGATTACTGCTGGTATTC pLKO.1 764 CDS 100% 10.800 7.560 N Wrap53 n/a
6 TRCN0000298500 CTATGATTACTGCTGGTATTC pLKO_005 764 CDS 100% 10.800 7.560 N WRAP53 n/a
7 TRCN0000000313 CACCAATCAGCGCATCTACTT pLKO.1 1322 CDS 100% 4.950 3.465 N WRAP53 n/a
8 TRCN0000000314 CACCCAACCTGAGAACTTCTT pLKO.1 581 CDS 100% 4.950 3.465 N WRAP53 n/a
9 TRCN0000293319 CACCCAACCTGAGAACTTCTT pLKO_005 581 CDS 100% 4.950 3.465 N WRAP53 n/a
10 TRCN0000000315 CATATCTGGGACGCATTCACT pLKO.1 849 CDS 100% 3.000 2.100 N WRAP53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03531 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03531 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465643 AGCTAGGATTAACCCGATAGTATT pLX_317 13.1% 100% 100% V5 n/a
Download CSV