Construct: ORF TRCN0000465667
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006014.1_s317c1
- Derived from:
- ccsbBroadEn_07985
- DNA Barcode:
- GGTGTCTAATCGGGGCTCTAGGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RTL8A (26071)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465667
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26071 | RTL8A | retrotransposon Gag like 8A | NM_001078172.1 | 99.4% | 98.2% | 142A>T;333G>T |
| 2 | human | 441518 | RTL8B | retrotransposon Gag like 8B | NM_001078173.2 | 95.8% | 94.6% | (many diffs) |
| 3 | human | 8933 | RTL8C | retrotransposon Gag like 8C | NM_001078171.2 | 94.9% | 92.9% | (many diffs) |
| 4 | human | 26071 | RTL8A | retrotransposon Gag like 8A | NM_001134321.2 | 67.5% | 54% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 405
- ORF length:
- 339
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaataag 61 ttggcatgga cggtcgggtg cagctgatga aggccctcct ggccgggccc ctccggcccg 121 cggcgcgtcg ctggaggaac ccgattccct ttcccgagac gtttgacgga gataccgacc 181 gactcccgga gttcatcgtg cagacgtgct cctacatgtt cgtggacgag aacacgttct 241 ccaacgacgc cctgaaggtg acgttcctca tcacccgcct cacggggcca gccctgcagt 301 gggtgaTCCC CTACATCAGG AAGGAGAGCC CCCTGCTCAA TGATTACCGG GGCTTCCTGG 361 CCGAGATGAA GCGGGTCTTT GGATGGGAGG AGGACGATGA CTTCTACCCA ACTTTCTTGT 421 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 481 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTCGATTTCT TGGCTTTATA TATCTTGTGG 541 AAAGGACGAG GTGTCTAATC GGGGCTCTAG GGCACGCGTT AAGTCgacaa tcaacctctg 601 gattacaaaa tttgtgaaag att