Transcript: Human NM_001134321.2

Homo sapiens retrotransposon Gag like 8A (RTL8A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
RTL8A (26071)
Length:
656
CDS:
28..279

Additional Resources:

NCBI RefSeq record:
NM_001134321.2
NBCI Gene record:
RTL8A (26071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263825 ACATAGCTGCCAGGGCTTAAG pLKO_005 423 3UTR 100% 10.800 7.560 N RTL8A n/a
2 TRCN0000263823 TCTTGTGTTCCTGCCACATAG pLKO_005 408 3UTR 100% 10.800 7.560 N RTL8A n/a
3 TRCN0000263822 ATCCACCGCATCTCACCAACA pLKO_005 244 CDS 100% 4.050 2.835 N RTL8A n/a
4 TRCN0000263824 TGCCTGGCAACCAAATCGAAT pLKO_005 446 3UTR 100% 4.950 2.970 N RTL8A n/a
5 TRCN0000263821 AGACTGTGGCTCCTAGTGATG pLKO_005 264 CDS 100% 4.050 2.430 N RTL8A n/a
6 TRCN0000268890 TCGTGGACGAGAACACGTTCT pLKO_005 182 CDS 100% 4.050 2.025 Y RTL8B n/a
7 TRCN0000268840 TGGAGGAACCCGATTCCCTTT pLKO_005 94 CDS 100% 4.050 2.025 Y RTL8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07985 pDONR223 100% 67.5% 54% None (many diffs) n/a
2 ccsbBroad304_07985 pLX_304 0% 67.5% 54% V5 (many diffs) n/a
3 TRCN0000465667 GGTGTCTAATCGGGGCTCTAGGGC pLX_317 30.3% 67.5% 54% V5 (many diffs) n/a
4 ccsbBroadEn_05680 pDONR223 100% 64.5% 53.2% None (many diffs) n/a
5 ccsbBroad304_05680 pLX_304 0% 64.5% 53.2% V5 (many diffs) n/a
6 TRCN0000470157 GCCGGTAGGCGTGTGCACGGCCCG pLX_317 100% 64.5% 53.2% V5 (many diffs) n/a
7 ccsbBroadEn_02049 pDONR223 100% 59.2% 50% None (many diffs) n/a
8 ccsbBroad304_02049 pLX_304 0% 59.2% 50% V5 (many diffs) n/a
9 TRCN0000468417 CTTTGCCTCGTGATCTTTACCCCT pLX_317 100% 59.2% 50% V5 (many diffs) n/a
Download CSV