Construct: ORF TRCN0000465753
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003916.1_s317c1
- Derived from:
- ccsbBroadEn_08886
- DNA Barcode:
- CTGCTGCGTTCCGGAACTCCGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- REEP1 (65055)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465753
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_022912.3 | 99.8% | 100% | 285G>A |
| 2 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_017004727.1 | 94.9% | 92.7% | (many diffs) |
| 3 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_001164730.2 | 91.5% | 89.2% | (many diffs) |
| 4 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_017004726.1 | 89.7% | 87.7% | (many diffs) |
| 5 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_001164731.2 | 86.4% | 80.5% | 0_1insATGGTGTC;23_24ins73;204G>A |
| 6 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_001371280.1 | 76.1% | 73.3% | (many diffs) |
| 7 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_017004725.1 | 70.6% | 68.1% | (many diffs) |
| 8 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_001371279.1 | 70.4% | 69.7% | (many diffs) |
| 9 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_011533044.1 | 68% | 66.1% | (many diffs) |
| 10 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_011533045.2 | 67.3% | 65.8% | (many diffs) |
| 11 | human | 65055 | REEP1 | receptor accessory protein 1 | XM_005264504.1 | 57% | 56.3% | (many diffs) |
| 12 | human | 65055 | REEP1 | receptor accessory protein 1 | NM_001164732.2 | 55.4% | 41.4% | 181_182ins235;369_429del |
| 13 | mouse | 52250 | Reep1 | receptor accessory protein 1 | NM_178608.4 | 91.8% | 98% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 669
- ORF length:
- 603
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gtcatggatc atctccaggc tggtggtgct tatatttggc accctttacc 121 ctgcgtatta ttcctacaag gctgtgaaat caaaggacat taaggaatat gtcaaatgga 181 tgatgtactg gattatattt gcacttttca ccacagcaga gacattcaca gacatcttcc 241 tttgttggtt tccattctat tatgaactaa aaatagcatt tgtagcctgg ctgctgtctc 301 cctacacaaa aggctccagc ctcctgtaca ggaagtttgt acatcccaca ctatcttcaa 361 aagaaaagga aatcgatgat tgtctggtcc aagcaaaaga ccGAAGTTAC GATGCCCTTG 421 TGCACTTCGG GAAGCGGGGC TTGAACGTGG CCGCCACAGC GGCTGTGATG GCTGCTTCCA 481 AGGGACAGGG TGCCTTATCG GAGAGACTGC GGAGCTTCAG CATGCAGGAC CTCACCACCA 541 TCAGGGGAGA CGGCGCCCCT GCTCCCTCGG GCCCCCCACC ACCGGGGTCT GGGCGGGCCA 601 GCGGCAAACA CGGCCAGCCT AAGATGTCCA GGAGTGCTTC TGAGAGCGCT AGCAGCTCAG 661 GCACCGCCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 721 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 781 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACTGCTG CGTTCCGGAA CTCCGTTTAC 841 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt