Transcript: Human XM_011533045.2

PREDICTED: Homo sapiens receptor accessory protein 1 (REEP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REEP1 (65055)
Length:
3892
CDS:
16..846

Additional Resources:

NCBI RefSeq record:
XM_011533045.2
NBCI Gene record:
REEP1 (65055)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364765 ACCCTTTACCCTGCGTATTAT pLKO_005 37 CDS 100% 15.000 21.000 N REEP1 n/a
2 TRCN0000377289 CACAATTGGATTGTCATTATA pLKO_005 1106 3UTR 100% 15.000 21.000 N REEP1 n/a
3 TRCN0000061733 CCCTGCGTATTATTCCTACAA pLKO.1 45 CDS 100% 4.950 6.930 N REEP1 n/a
4 TRCN0000061737 GACATCTTCCTTTGTTGGTTT pLKO.1 157 CDS 100% 4.950 6.930 N REEP1 n/a
5 TRCN0000369451 CCGCCTAGAATCCTTCGATCT pLKO_005 778 CDS 100% 4.050 5.670 N REEP1 n/a
6 TRCN0000364708 TCTTTGTTCTTGGTACTTATA pLKO_005 1255 3UTR 100% 13.200 9.240 N REEP1 n/a
7 TRCN0000061734 GCTTATATTTGGCACCCTTTA pLKO.1 24 CDS 100% 10.800 7.560 N REEP1 n/a
8 TRCN0000377323 GTTTGTACATCCCACGCTATC pLKO_005 261 CDS 100% 6.000 4.200 N REEP1 n/a
9 TRCN0000061735 CTTTGTTGGTTTCCATTCTAT pLKO.1 166 CDS 100% 5.625 3.938 N REEP1 n/a
10 TRCN0000364766 TGGATGATGTACTGGATTATA pLKO_005 103 CDS 100% 15.000 9.000 N REEP1 n/a
11 TRCN0000369512 GTGAAATCAAAGGACATTAAG pLKO_005 70 CDS 100% 13.200 7.920 N REEP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08886 pDONR223 100% 67.3% 65.8% None (many diffs) n/a
2 ccsbBroad304_08886 pLX_304 0% 67.3% 65.8% V5 (many diffs) n/a
3 TRCN0000465753 CTGCTGCGTTCCGGAACTCCGTTT pLX_317 44.4% 67.3% 65.8% V5 (many diffs) n/a
Download CSV