Construct: ORF TRCN0000465821
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014621.1_s317c1
- Derived from:
- ccsbBroadEn_09831
- DNA Barcode:
- ACCGACGCATGTGACATACGACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CERS3 (204219)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465821
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 204219 | CERS3 | ceramide synthase 3 | NM_001290342.2 | 99.8% | 99.7% | 159A>G;1108A>G |
| 2 | human | 204219 | CERS3 | ceramide synthase 3 | NM_001290343.2 | 99.8% | 99.7% | 159A>G;1108A>G |
| 3 | human | 204219 | CERS3 | ceramide synthase 3 | NM_178842.5 | 99.8% | 99.7% | 159A>G;1108A>G |
| 4 | human | 204219 | CERS3 | ceramide synthase 3 | XM_017022003.1 | 99.8% | 99.7% | 159A>G;1108A>G |
| 5 | human | 204219 | CERS3 | ceramide synthase 3 | XM_017022004.1 | 99.8% | 99.7% | 159A>G;1108A>G |
| 6 | human | 204219 | CERS3 | ceramide synthase 3 | NM_001290341.2 | 97% | 96.9% | 1_33del;192A>G;1141A>G |
| 7 | human | 204219 | CERS3 | ceramide synthase 3 | XM_011521355.2 | 97% | 96.9% | 1_33del;192A>G;1141A>G |
| 8 | human | 204219 | CERS3 | ceramide synthase 3 | XM_011521357.2 | 97% | 96.9% | 1_33del;192A>G;1141A>G |
| 9 | human | 204219 | CERS3 | ceramide synthase 3 | XM_011521358.1 | 97% | 96.9% | 1_33del;192A>G;1141A>G |
| 10 | human | 204219 | CERS3 | ceramide synthase 3 | XM_017022002.1 | 97% | 96.9% | 1_33del;192A>G;1141A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1215
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ttggacgttt aaagaatggt tctggttgga aagattctgg cttcctccaa 121 caataaagtg gtcagatctt gaggatcacg atggactcgt ctttgtaaaa ccttctcatt 181 tatacgtgac aattccatat gcttttctct tgctgattat caggcgtgta tttgaaaaat 241 ttgttgcttc acctctagca aaatcatttg gcattaaaga gacagttcga aaggttacac 301 caaatactgt cttagagaat tttttcaaac attccacaag gcaaccattg caaactgata 361 tttatggact ggcaaagaag tgtaacttga cggagcgcca ggtggaaaga tggtttagga 421 gtcggcggaa tcaagagagg ccttccaggc tgaagaaatt ccaggaagct tgctggagat 481 ttgcatttta cttaatgatc actgttgctg gaattgcgtt tctttatgat aaaccttggc 541 tatatgactt atgggaggtt tggaatggct atcccaaaca gcccctgctg ccatcccagt 601 actggtacta cattttagaa atgagttttt attggtctct gttatttaga cttggctttg 661 atgtcaagag aaaggatttt ctagctcata tcatccacca cctggctgct attagtctga 721 tgagcttctc ttggtgtgct aattatattc gcagtgggac cctcgtgatg attgtacacg 781 atgtggctga catttggctg gagtctgcta agatgttttc ttatgctgga tggacgcaga 841 cctgtaacac cctgtttttc atcttctcca ccatattttt catcagccgc ctcattgttt 901 ttcctttctg gattttatat tgcacgctga tcttgcctat gtatcacctc gagcctttct 961 tttcatacat cttcctcaac ctacagctca tgatcttgca ggtccttcac ctttactggg 1021 gttattacat cttgaagatg ctcaacagat gtatattcat gaagagcatc caggatgtga 1081 ggagtgatga cgaggattat gaagaggaag aggaagagga agaagaagag gctaccaaag 1141 gcaaagagat ggattgtttA AAGAACGGCC TCGGGGCTGA GAGGCACCTC ATTCCCAATG 1201 GCCAGCATGG CCATTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1261 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1321 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ACCGACGCAT GTGACATACG 1381 ACTGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt