Transcript: Human NM_178842.5

Homo sapiens ceramide synthase 3 (CERS3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
CERS3 (204219)
Length:
3857
CDS:
388..1539

Additional Resources:

NCBI RefSeq record:
NM_178842.5
NBCI Gene record:
CERS3 (204219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178842.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420449 GCTGATTATCAGACGTGTATT pLKO_005 534 CDS 100% 13.200 10.560 N CERS3 n/a
2 TRCN0000435826 AGGAGTGATGACGAGGATTAT pLKO_005 1402 CDS 100% 13.200 9.240 N CERS3 n/a
3 TRCN0000019752 GCAAAGAGATGGATTGTTTAA pLKO.1 1463 CDS 100% 13.200 9.240 N CERS3 n/a
4 TRCN0000019753 GCTTCTCTTGGTGTGCTAATT pLKO.1 1046 CDS 100% 13.200 9.240 N CERS3 n/a
5 TRCN0000019751 CAGACCTGTAACACCCTGTTT pLKO.1 1159 CDS 100% 4.950 3.465 N CERS3 n/a
6 TRCN0000019750 CCAAATACTGTCTTAGAGAAT pLKO.1 622 CDS 100% 4.950 3.465 N CERS3 n/a
7 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 1426 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178842.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09831 pDONR223 100% 99.8% 99.7% None 159A>G;1108A>G n/a
2 ccsbBroad304_09831 pLX_304 0% 99.8% 99.7% V5 159A>G;1108A>G n/a
3 TRCN0000465821 ACCGACGCATGTGACATACGACTG pLX_317 5.6% 99.8% 99.7% V5 159A>G;1108A>G n/a
4 ccsbBroadEn_16124 pDONR223 0% 99.5% 99.4% None 159A>G;428_430delTAA;1108A>G n/a
5 ccsbBroad304_16124 pLX_304 0% 99.5% 99.4% V5 159A>G;428_430delTAA;1108A>G n/a
6 TRCN0000472321 CGTAAACGGGGCGCCCAGACCGTC pLX_317 34.1% 99.5% 99.4% V5 159A>G;428_430delTAA;1108A>G n/a
Download CSV