Construct: ORF TRCN0000465852
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015043.1_s317c1
- Derived from:
- ccsbBroadEn_04592
- DNA Barcode:
- CATAGTAGCGCACTACAGTTTAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- REEP6 (92840)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465852
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 92840 | REEP6 | receptor accessory protein 6 | NM_138393.4 | 100% | 100% | |
| 2 | human | 92840 | REEP6 | receptor accessory protein 6 | NM_001329556.3 | 87.2% | 87.2% | 518_598del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 618
- ORF length:
- 552
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cggcctgagg cagcgcgtgg agcacttcct ggagcaaagg aacctggtca 121 ccgaagtgct gggggcgctg gaggccaaga ccggggtgga gaagcggtat ctggctgcag 181 gagccgtcac tctgctaagc ctgtatctgc tgttcggcta cggagcgtct ctgctgtgca 241 atctcatcgg atttgtgtac cccgcatatg cctcaatcaa agctatcgag agcccaagca 301 aggacgacga cactgtgtgg ctcaccTACT GGGTGGTGTA CGCCCTGTTT GGGCTGGCCG 361 AGTTCTTCAG CGATCTACTC CTGTCCTGGT TCCCTTTCTA CTACGTGGGC AAGTGCGCCT 421 TCCTGTTGTT CTGCATGGCT CCCAGGCCCT GGAACGGGGC TCTCATGCTG TATCAGCGCG 481 TCGTGCGTCC GCTGTTCCTA AGGCACCACG GGGCCGTAGA CAGAATCATG AACGACCTCA 541 GCGGGCGAGC CCTGGACGCG GCGGCCGGAA TAACCAGGAA CGTCAAGCCA AGCCAGACCC 601 CGCAGCCGAA GGACAAGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 661 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 721 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACATAGTA GCGCACTACA 781 GTTTAGCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt