Transcript: Human NM_138393.4

Homo sapiens receptor accessory protein 6 (REEP6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
REEP6 (92840)
Length:
1360
CDS:
90..644

Additional Resources:

NCBI RefSeq record:
NM_138393.4
NBCI Gene record:
REEP6 (92840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060543 CGCCAGAAGGAATCGTCGAAA pLKO.1 1148 3UTR 100% 4.950 6.930 N REEP6 n/a
2 TRCN0000450774 GGCCGTAGACAGAATCATGAA pLKO_005 536 CDS 100% 4.950 6.930 N REEP6 n/a
3 TRCN0000449680 CTTTCTACTACGTGGGCAAGT pLKO_005 418 CDS 100% 4.050 5.670 N REEP6 n/a
4 TRCN0000060546 CGGAATAACCAGGAACGTCAA pLKO.1 590 CDS 100% 4.050 3.240 N REEP6 n/a
5 TRCN0000060545 GCCGAGTTCTTCAGCGATCTA pLKO.1 381 CDS 100% 4.950 3.465 N REEP6 n/a
6 TRCN0000060547 GCTAAGCCTGTATCTGCTGTT pLKO.1 218 CDS 100% 4.050 2.835 N REEP6 n/a
7 TRCN0000060544 GCTGTGCAATCTCATCGGATT pLKO.1 257 CDS 100% 4.050 2.835 N REEP6 n/a
8 TRCN0000441483 AGCTATCGAGAGCCCAAGCAA pLKO_005 305 CDS 100% 3.000 2.100 N REEP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04592 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04592 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465852 CATAGTAGCGCACTACAGTTTAGC pLX_317 52.7% 100% 100% V5 n/a
Download CSV