Construct: ORF TRCN0000465887
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016688.1_s317c1
- Derived from:
- ccsbBroadEn_00231
- DNA Barcode:
- ACCCGATCCTGGGATTCCCTATCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CBFB (865)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465887
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 865 | CBFB | core-binding factor subunit... | NM_001755.3 | 100% | 100% | |
2 | human | 865 | CBFB | core-binding factor subunit... | NM_022845.3 | 86.9% | 85.2% | 494_495ins31;516_561del |
3 | human | 865 | CBFB | core-binding factor subunit... | NM_001368709.1 | 78.5% | 78.5% | 165_166ins117 |
4 | human | 865 | CBFB | core-binding factor subunit... | NM_001368710.1 | 78.5% | 78.5% | 280_281ins117 |
5 | human | 865 | CBFB | core-binding factor subunit... | NM_001368707.1 | 67.2% | 65.4% | 165_166ins117;377_378ins31;399_444del |
6 | human | 865 | CBFB | core-binding factor subunit... | NM_001368708.1 | 67.2% | 65.4% | 280_281ins117;377_378ins31;399_444del |
7 | mouse | 12400 | Cbfb | core binding factor beta | NM_001161458.1 | 94.5% | 98.3% | (many diffs) |
8 | mouse | 12400 | Cbfb | core binding factor beta | NM_022309.4 | 81.9% | 84.2% | (many diffs) |
9 | mouse | 12400 | Cbfb | core binding factor beta | NM_001161457.1 | 77.1% | 74.1% | (many diffs) |
10 | mouse | 12400 | Cbfb | core binding factor beta | NM_001161456.1 | 62.8% | 64.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 612
- ORF length:
- 546
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gcgcgtcgtg cccgaccaga gaagcaagtt cgagaacgag gagtttttta 121 ggaagctgag ccgcgagtgt gagattaagt acacgggctt cagggaccgg ccccacgagg 181 aacgccaggc acgcttccag aacgcctgcc gcgacggccg ctcggaaatc gcttttgtgg 241 ccacaggaac caatctgtct ctccagtttt ttccggccag ctggcaggga gaacagcgac 301 aaacacctag ccgagagtat gtcgacttag aaagagaagc aggcaaggta tatttgaagg 361 ctcccatgat tctgaatgga gtctgtgtta tctggaaagg ctggattgat ctccaaagac 421 tggatggtat gggctgtctg gagtttgatg aggagcgagc ccagcaggag gatgcattag 481 cacaacaggc ctttgaagag gctcggagaa ggacacgcga atttgaagat agagacaggt 541 cTCATCGGGA GGAAATGGAG GTGAGAGTTT CACAGCTGCT GGCAGTAACT GGCAAGAAGA 601 CAACAAGACC CTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 661 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 721 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAACC CGATCCTGGG ATTCCCTATC 781 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t