Transcript: Human NM_001368707.1

Homo sapiens core-binding factor subunit beta (CBFB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CBFB (865)
Length:
2986
CDS:
260..706

Additional Resources:

NCBI RefSeq record:
NM_001368707.1
NBCI Gene record:
CBFB (865)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275239 TGACCTCAAACTTCGTTAATT pLKO_005 688 CDS 100% 15.000 21.000 N CBFB n/a
2 TRCN0000016644 CCGCGAGTGTGAGATTAAGTA pLKO.1 325 CDS 100% 5.625 7.875 N CBFB n/a
3 TRCN0000275242 CCGCGAGTGTGAGATTAAGTA pLKO_005 325 CDS 100% 5.625 7.875 N CBFB n/a
4 TRCN0000016647 TGAGATTAAGTACACGGGCTT pLKO.1 334 CDS 100% 2.160 3.024 N CBFB n/a
5 TRCN0000016645 GAAGATAGAGACAGGTCTCAT pLKO.1 602 CDS 100% 4.950 3.465 N CBFB n/a
6 TRCN0000275241 GAAGATAGAGACAGGTCTCAT pLKO_005 602 CDS 100% 4.950 3.465 N CBFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00231 pDONR223 100% 67.2% 65.4% None 165_166ins117;377_378ins31;399_444del n/a
2 ccsbBroad304_00231 pLX_304 0% 67.2% 65.4% V5 165_166ins117;377_378ins31;399_444del n/a
3 TRCN0000465887 ACCCGATCCTGGGATTCCCTATCG pLX_317 14.3% 67.2% 65.4% V5 165_166ins117;377_378ins31;399_444del n/a
Download CSV