Construct: ORF TRCN0000466055
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017363.1_s317c1
- Derived from:
- ccsbBroadEn_09430
- DNA Barcode:
- CCAACACGTTGATCTATCGAGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZMYND19 (116225)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466055
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 116225 | ZMYND19 | zinc finger MYND-type conta... | NM_138462.3 | 99.8% | 100% | 12C>T |
| 2 | human | 116225 | ZMYND19 | zinc finger MYND-type conta... | XM_005266052.4 | 76.1% | 72.9% | (many diffs) |
| 3 | human | 116225 | ZMYND19 | zinc finger MYND-type conta... | XM_017014255.1 | 23.3% | 20.2% | (many diffs) |
| 4 | mouse | 67187 | Zmynd19 | zinc finger, MYND domain co... | NM_026021.4 | 90.4% | 100% | (many diffs) |
| 5 | mouse | 67187 | Zmynd19 | zinc finger, MYND domain co... | NM_147179.1 | 74.1% | 82.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 747
- ORF length:
- 681
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cgactttaaa ttgggtatcg tgcggctcgg ccgggtggcc gggaagacca 121 aatacacgct gatcgatgag caggacatcc cgctggtgga gagctactcc tttgaggccc 181 gaatggaagt ggatgcagat ggaaatggtg ctaagatatt tgcctatgcc tttgacaaga 241 accgaggaag gggctctggg agactccttc atgagctgct gtgggagcgg caccgggggg 301 gcgtggcccc gggcttccag gtggtgcacc tcaacgctgt gaccgtggac aatcgcctgg 361 acaacctgca actggtgccg tggggctggc ggcccaaggc tgaagagacc TCCAGCAAGC 421 AGAGGGAGCA AAGCTTGTAT TGGCTTGCAA TTCAGCAGCT GCCTACAGAC CCTATAGAAG 481 AACAGTTTCC TGTCCTAAAT GTGACCCGGT ATTATAATGC CAACGGGGAT GTAGTGGAAG 541 AGGAGGAGAA CTCTTGCACC TACTATGAGT GCCACTACCC TCCCTGCACA GTGATTGAGA 601 AGCAGCTCCG GGAGTTCAAC ATCTGTGGGC GCTGCCAGGT GGCCCGGTAC TGCGGCTCCC 661 AGTGCCAGCA GAAGGACTGG CCTGCCCACA AGAAGCACTG TCGGGAGAGG AAGCGTCCCT 721 TCCAGCATGA GCTTGAGCCA GAGCGATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 781 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 841 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCAACACG 901 TTGATCTATC GAGCCCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 961 aagatt