Transcript: Mouse NM_026021.4

Mus musculus zinc finger, MYND domain containing 19 (Zmynd19), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Zmynd19 (67187)
Length:
2713
CDS:
221..904

Additional Resources:

NCBI RefSeq record:
NM_026021.4
NBCI Gene record:
Zmynd19 (67187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026021.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216805 GAATGTGACCCGGTACTATAA pLKO.1 652 CDS 100% 13.200 18.480 N Zmynd19 n/a
2 TRCN0000353203 AGCTTCCCACAGACCCTATAG pLKO_005 612 CDS 100% 10.800 8.640 N Zmynd19 n/a
3 TRCN0000233145 GGAAATGGTGCTAAGATATTT pLKO_005 356 CDS 100% 15.000 10.500 N ZMYND19 n/a
4 TRCN0000345452 TGAATGTGACCCGGTACTATA pLKO_005 651 CDS 100% 13.200 9.240 N Zmynd19 n/a
5 TRCN0000244511 ATCCAGAGCAGCTGCCATAAG pLKO_005 1015 3UTR 100% 10.800 7.560 N Zmynd19 n/a
6 TRCN0000244510 GTGCCAAAGAAGCCAGCAATG pLKO_005 993 3UTR 100% 6.000 4.200 N Zmynd19 n/a
7 TRCN0000151236 GATGGAAATGGTGCTAAGATA pLKO.1 353 CDS 100% 5.625 3.938 N ZMYND19 n/a
8 TRCN0000179311 GAAGACAGACTGTCAGTTGAA pLKO.1 965 3UTR 100% 4.950 3.465 N Zmynd19 n/a
9 TRCN0000183528 GAAGACCAAATACACACTGAT pLKO.1 268 CDS 100% 4.950 3.465 N Zmynd19 n/a
10 TRCN0000257153 GCGGAAGACAGACTGTCAGTT pLKO_005 962 3UTR 100% 4.950 3.465 N Zmynd19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026021.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09430 pDONR223 100% 90.4% 100% None (many diffs) n/a
2 ccsbBroad304_09430 pLX_304 0% 90.4% 100% V5 (many diffs) n/a
3 TRCN0000466055 CCAACACGTTGATCTATCGAGCCC pLX_317 49.5% 90.4% 100% V5 (many diffs) n/a
Download CSV