Construct: ORF TRCN0000466181
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007545.1_s317c1
- Derived from:
- ccsbBroadEn_12357
- DNA Barcode:
- AATTAGTGTGTTATCATTAAAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPTOR (57521)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466181
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57521 | RPTOR | regulatory associated prote... | NM_001163034.2 | 32.2% | 32.2% | 1138_3531del |
2 | human | 57521 | RPTOR | regulatory associated prote... | NM_020761.3 | 28.3% | 28.3% | 1138_4005del |
3 | mouse | 74370 | Rptor | regulatory associated prote... | NM_028898.3 | 25.2% | 28.2% | (many diffs) |
4 | mouse | 74370 | Rptor | regulatory associated prote... | XM_006534363.2 | 25% | 23.9% | (many diffs) |
5 | mouse | 74370 | Rptor | regulatory associated prote... | XM_006534361.3 | 23.8% | 26.7% | (many diffs) |
6 | mouse | 74370 | Rptor | regulatory associated prote... | XM_006534362.1 | 21.6% | 24.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1203
- ORF length:
- 1137
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtccgaaatg ctgcaatcgc ctcttctggg cctgggggag gaagatgagg 121 ctgatcttac agactggaac ctacctttgg cttttatgaa aaagaggcac tgtgagaaaa 181 ttgaaggctc caaatcctta gctcagagct ggaggatgaa ggatcggatg aagacagtca 241 gtgttgcctt agttttgtgc ctgaatgttg gtgtggaccc tcccgatgtg gtgaagacca 301 cgccctgtgc acgcttggaa tgctggatcg atcctctgtc gatgggtcct cagaaagctc 361 tggaaaccat cggtgcaaat ttacagaagc agtacgagaa ctggcagcca agggcccggt 421 acaagcagag ccttgaccca actgtggatg aagtcaagaa gctctgcacg tccttacgtc 481 gcaacgccaa ggaggagcga gtcctctttc actacaatgg ccacggggtg ccccggccca 541 cagtcaacgg ggaggtctgg gtcttcaaca agaactacac gcagtacatc cctctgtcca 601 tatatgacct gcagacgtgg atgggcagcc cgtcgatctt cgtctacgac tgctccaatg 661 ctggcttgat cgtcaagtcc ttcaagcagt tcgcactaca gcgggagcag gagctggagg 721 tagctgcaat caacccaaat caccctcttg ctcagatgcc tttgcctccg tcgatgaaaa 781 actgcatcca gctggcagcc tgcgaggcca ccgagctgct gcccatgatc cccgacctcc 841 cggctgacct attcacctcc tgcctcacca cccccatcaa gatcgccctg cgctggtttt 901 gcatgcagaa atgtgtcagt ctggtgcctg gcgtcacact ggatttgata gaaaagatcc 961 ctggccgcct gaacgacagg aggacgcccc tgggtgaact gaactggatc ttcacagcca 1021 tcacagacac catcgcgtgg aacgtgctcc cccgggatcT CTTCCAAAAG CTCTTCAGAC 1081 AGGACTTGCT GGTGGCTAGT CTGTTTCGAA ATTTTTTATT GGCGGAAAGG ATTATGAGGT 1141 CGTATAACTG CACTCCCGTC AGCAGCCCGC GTCTGCCGCC CACGTACATG CACGCCATGT 1201 GGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1261 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1321 GGCTTTATAT ATCTTGTGGA AAGGACGAAA TTAGTGTGTT ATCATTAAAG GTACGCGTTA 1381 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt