Transcript: Mouse XM_006534362.1

PREDICTED: Mus musculus regulatory associated protein of MTOR, complex 1 (Rptor), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rptor (74370)
Length:
6079
CDS:
303..4148

Additional Resources:

NCBI RefSeq record:
XM_006534362.1
NBCI Gene record:
Rptor (74370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077472 GCCCGAGTCTGTGAATGTAAT pLKO.1 3869 CDS 100% 13.200 9.240 N Rptor n/a
2 TRCN0000077468 CGTGGCAAGTTTGTTTAGAAA pLKO.1 1166 CDS 100% 5.625 3.938 N Rptor n/a
3 TRCN0000077470 CCTATCCAGATGTTTCTGATT pLKO.1 2605 CDS 100% 4.950 3.465 N Rptor n/a
4 TRCN0000077471 CCTCATCGTCAAGTCCTTCAA pLKO.1 740 CDS 100% 4.950 3.465 N Rptor n/a
5 TRCN0000077469 GCTGCGATTAACCCAAACCAT pLKO.1 798 CDS 100% 3.000 2.100 N Rptor n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12357 pDONR223 100% 21.6% 24.2% None (many diffs) n/a
2 ccsbBroad304_12357 pLX_304 53.9% 21.6% 24.2% V5 (many diffs) n/a
3 TRCN0000466181 AATTAGTGTGTTATCATTAAAGGT pLX_317 13.3% 21.6% 24.2% V5 (many diffs) n/a
Download CSV