Construct: ORF TRCN0000466232
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004966.1_s317c1
- Derived from:
- ccsbBroadEn_01934
- DNA Barcode:
- TCAATGTACTGGCAAAGTAGGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FKBP6 (8468)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466232
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | NM_003602.5 | 99.8% | 100% | 594A>G |
| 2 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | NM_001135211.3 | 96.8% | 95.4% | (many diffs) |
| 3 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | XM_017012741.1 | 95.3% | 93.8% | (many diffs) |
| 4 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | NM_001281304.2 | 90.7% | 90.8% | 174_175ins90;504A>G |
| 5 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | NM_001362789.2 | 84.6% | 83.1% | (many diffs) |
| 6 | human | 8468 | FKBP6 | FKBP prolyl isomerase 6 | XM_017012742.1 | 76.6% | 74.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1047
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gggaagcgcg ttaaaccagg gagtcctgga aggggacgac gcccccggcc 121 agtccctgta cgagcggtta agtcagagga tgctggacat ctcgggggac cggggcgtgc 181 tgaaggacgt catccgagaa ggagctggag acctagtggc gcctgatgct tcggtgctag 241 tgaaatactc gggatacctg gaacacatgg acagaccctt cgattctaat tactttagga 301 aaactcctcg gctaatgaaa cttggagagg atattacact gtggggcatg gagctgggcc 361 ttctgagcat gcggagagga gagctggcca ggtttctgtt caaaccgaac tacgcctatg 421 gaacgctggg ctgccctccc ttgatccccc caaacaccac tgtcctgttt gagattgagc 481 tgcttgactt cctggactgt gctgagtcag acaagttttg tgctctctca gctgagcagc 541 aagaccaatt tccacttcag aaggtcctga aagtggcagc tacggaacgg gagtttggca 601 actaCCTTTT CCGCCAGAAT CGTTTCTATG ATGCCAAAGT GAGATATAAA AGGGCCCTGT 661 TGCTTCTGCG CCGGCGATCA GCACCCCCTG AAGAGCAGCA CCTGGTGGAG GCCGCCAAGC 721 TTCCTGTTCT CCTGAACCTG TCCTTTACAT ACCTGAAGCT AGACCGACCC ACCATAGCCC 781 TGTGCTATGG AGAGCAGGCT TTGATCATTG ACCAAAAGAA TGCCAAGGCC CTCTTCAGGT 841 GTGGACAGGC TTGTCTTCTC CTGACTGAGT ATCAAAAGGC CCGGGATTTT CTAGTTCGAG 901 CCCAGAAGGA GCAACCCTTC AATCATGACA TCAATAATGA GCTGAAGAAA CTGGCTAGCT 961 GTTACAGGGA CTATGTGGAT AAAGAGAAAG AAATGTGGCA CCGCATGTTC GCGCCCTGTG 1021 GCGATGGTTC TACAGCAGGA GAAAGTTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCAATGTA 1201 CTGGCAAAGT AGGCACACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt