Construct: ORF TRCN0000466317
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005229.1_s317c1
- Derived from:
- ccsbBroadEn_03255
- DNA Barcode:
- GGGCATCTCTCTGCAGTCTTGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTRES1 (51250)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466317
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51250 | MTRES1 | mitochondrial transcription... | NM_001142468.3 | 100% | 100% | |
| 2 | human | 51250 | MTRES1 | mitochondrial transcription... | NM_016487.5 | 100% | 100% | |
| 3 | human | 51250 | MTRES1 | mitochondrial transcription... | NM_001142470.3 | 97.9% | 97.9% | 1_15del |
| 4 | human | 51250 | MTRES1 | mitochondrial transcription... | XM_011535876.3 | 97.9% | 97.9% | 1_15del |
| 5 | human | 51250 | MTRES1 | mitochondrial transcription... | XM_011535877.3 | 97.9% | 97.9% | 1_15del |
| 6 | human | 51250 | MTRES1 | mitochondrial transcription... | XM_017010919.2 | 97.9% | 97.9% | 1_15del |
| 7 | human | 51250 | MTRES1 | mitochondrial transcription... | XM_017010920.1 | 88.8% | 88.8% | 1_90del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 786
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tatggctagt gttaaattgc ttgccggtgt tttaagaaag ccagatgcct 121 ggattggact ctggggtgtt ctccgaggga caccttcatc atacaaactc tgtacttcct 181 ggaatcgata cttgtatttt tctagtacca agttacgtgc accaaattat aaaacacttt 241 tttataatat tttctcactg agactcccag ggcttttact atctccagaa tgtatttttc 301 ctttttccgt aagactcaaa agtaatataa ggtctacaaa atctactaaa aagtctctgc 361 aaaaagtaga tgaagaggac tctgatgaag aaagccatca tgatgagatg agtgagcagg 421 aagaggagct tgaggatgat cctactGTAG TCAAAAACTA TAAAGACCTG GAAAAAGCAG 481 TTCAGTCTTT TCGGTATGAT GTTGTCCTGA AGACGGGGCT AGATATTGGG AGAAACAAAG 541 TGGAAGATGC TTTCTACAAA GGTGAACTCA GGCTGAATGA GGAAAAATTA TGGAAGAAAA 601 GCAGAACGGT GAAAGTGGGA GATACATTGG ATCTTCTCAT TGGAGAGGAT AAAGAAGCAG 661 GAACAGAGAC AGTTATGCGG ATTCTCTTGA AAAAAGTGTT TGAAGAGAAG ACTGAAAGTG 721 AAAAATACAG AGTGGTGTTA CGGCGGTGGA AAAGTTTAAA GTTGCCTAAG AAGAGAATGT 781 CTAAATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 841 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTCCGATTT 901 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGGGCATCTC TCTGCAGTCT TGACAACGCG 961 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt