Transcript: Human XM_017010919.2

PREDICTED: Homo sapiens mitochondrial transcription rescue factor 1 (MTRES1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTRES1 (51250)
Length:
940
CDS:
97..834

Additional Resources:

NCBI RefSeq record:
XM_017010919.2
NBCI Gene record:
MTRES1 (51250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232634 CGAGGGACACCTTCATCATAC pLKO_005 190 CDS 100% 10.800 8.640 N MTRES1 n/a
2 TRCN0000232635 CAAGTTACGTGCACCAAATTA pLKO_005 255 CDS 100% 15.000 10.500 N MTRES1 n/a
3 TRCN0000232636 TACTATCTCCAGAATGTATTT pLKO_005 323 CDS 100% 13.200 9.240 N MTRES1 n/a
4 TRCN0000232638 TTCTCATTGGAGAGGATAAAG pLKO_005 680 CDS 100% 13.200 9.240 N MTRES1 n/a
5 TRCN0000232637 GTGAAAGTGGGAGATACATTG pLKO_005 655 CDS 100% 10.800 7.560 N MTRES1 n/a
6 TRCN0000167980 CTTGAGGATGATCCTACTGTA pLKO.1 475 CDS 100% 4.950 3.465 N MTRES1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03255 pDONR223 100% 97.9% 97.9% None 1_15del n/a
2 ccsbBroad304_03255 pLX_304 0% 97.9% 97.9% V5 1_15del n/a
3 TRCN0000466317 GGGCATCTCTCTGCAGTCTTGACA pLX_317 47.2% 97.9% 97.9% V5 1_15del n/a
Download CSV