Construct: ORF TRCN0000466318
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000753.1_s317c1
- Derived from:
- ccsbBroadEn_12243
- DNA Barcode:
- GGTACTTTGACGCCGCGTTAGGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRPF40A (55660)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466318
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_024452980.1 | 26% | 26% | 1_1833del |
2 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_024452979.1 | 25.9% | 25.9% | 1_1845del |
3 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365604.2 | 25.1% | 25.1% | 1_1923del |
4 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365605.2 | 25.1% | 25.1% | 1_1923del |
5 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_017004461.1 | 25.1% | 25.1% | 1_1923del |
6 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_017004458.2 | 25% | 25% | 1_1935del |
7 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_017004459.2 | 25% | 25% | 1_1935del |
8 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001354432.2 | 24.9% | 24.9% | 1_1941del |
9 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365603.2 | 24.5% | 24.5% | 1_1977del |
10 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_017004457.1 | 24.5% | 24.5% | 1_1977del |
11 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365602.2 | 24.4% | 24.4% | 1_1989del |
12 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_011511449.3 | 24.4% | 24.4% | 1_1989del |
13 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001354431.2 | 23.5% | 23.5% | 1_2091del |
14 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365601.2 | 23.4% | 23.4% | 1_2103del |
15 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_017892.4 | 23.1% | 23.1% | 1_2145del |
16 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365600.2 | 23% | 23% | 1_2157del |
17 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365599.2 | 22.5% | 22.5% | 1_2217del |
18 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365598.2 | 22.4% | 22.4% | 1_2229del |
19 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365597.2 | 22.1% | 22.1% | 1_2271del |
20 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | NM_001365596.2 | 22% | 22% | 1_2283del |
21 | human | 55660 | PRPF40A | pre-mRNA processing factor ... | XM_011511447.3 | 18.1% | 17.9% | (many diffs) |
22 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_011239140.2 | 23.2% | 24.2% | (many diffs) |
23 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_017319136.1 | 21.8% | 22.8% | (many diffs) |
24 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_006498195.2 | 21.5% | 22.4% | (many diffs) |
25 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_006498194.1 | 21.4% | 22.3% | (many diffs) |
26 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_017319135.1 | 21% | 21.8% | (many diffs) |
27 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | NM_018785.2 | 20.9% | 21.8% | (many diffs) |
28 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_006498193.2 | 20.9% | 21.8% | (many diffs) |
29 | mouse | 56194 | Prpf40a | pre-mRNA processing factor 40A | XM_006498192.2 | 20.5% | 21.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 711
- ORF length:
- 645
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa acgaaaagaa tctgcattta agagtatgtt aaaacaagct gctcctccga 121 tagaattgga tgctgtctgg gaagatatcc gtgagagatt tgtaaaagag ccagcatttg 181 aggacataac tctagaatct gaaagaaaac gaatatttaa agattttatg catgtgcttg 241 agcatgaatg tcagcatcat cattcaaaga acaagaaaca ttctaagaaa tctaaaaaac 301 atcataggaa acgttcccgc tctcgatcgg ggtcagattc agatgatgat gatagCCATT 361 CAAAGAAAAA AAGACAGCGA TCAGAGTCTC GTTCTGCTTC AGAACATTCT TCTAGTGCAG 421 AGTCTGAGAG AAGTTATAAA AAGTCAAAAA AGCATAAGAA GAAAAGTAAG AAGAGGAGAC 481 ATAAATCTGA CTCTCCAGAA TCCGATGCTG AGCGAGAGAA GGATAAAAAA GAAAAAGATC 541 GGGAAAGTGA AAAAGACAGA ACTAGACAAA GATCAGAATC AAAACACAAA TCGCCTAAGA 601 AAAAGACTGG AAAGGATTCT GGTAATTGGG ATACTTCTGG CAGCGAACTG AGTGAAGGGG 661 AATTGGAAAA GCGCAGAAGA ACCCTTTTGG AGCAACTGGA TGATGATCAA TACCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGAGGTA CTTTGACGCC GCGTTAGGAC ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt