Transcript: Mouse XM_006498195.2

PREDICTED: Mus musculus pre-mRNA processing factor 40A (Prpf40a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf40a (56194)
Length:
2798
CDS:
12..2792

Additional Resources:

NCBI RefSeq record:
XM_006498195.2
NBCI Gene record:
Prpf40a (56194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123462 GCTGAGCAACTATTGTCTAAA pLKO.1 462 CDS 100% 13.200 18.480 N Prpf40a n/a
2 TRCN0000316926 GCTGAGCAACTATTGTCTAAA pLKO_005 462 CDS 100% 13.200 18.480 N Prpf40a n/a
3 TRCN0000123460 GCTTGCTAATACCACAGCTAT pLKO.1 941 CDS 100% 4.950 3.960 N Prpf40a n/a
4 TRCN0000123463 CCCAGTTCCTACAACAGAAAT pLKO.1 701 CDS 100% 13.200 9.240 N Prpf40a n/a
5 TRCN0000316927 CCCAGTTCCTACAACAGAAAT pLKO_005 701 CDS 100% 13.200 9.240 N Prpf40a n/a
6 TRCN0000123461 GCTCTGACATTCGCTTCACTA pLKO.1 1840 CDS 100% 4.950 3.465 N Prpf40a n/a
7 TRCN0000316924 GCTCTGACATTCGCTTCACTA pLKO_005 1840 CDS 100% 4.950 3.465 N Prpf40a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12243 pDONR223 100% 21.5% 22.4% None (many diffs) n/a
2 ccsbBroad304_12243 pLX_304 0% 21.5% 22.4% V5 (many diffs) n/a
3 TRCN0000466318 GGTACTTTGACGCCGCGTTAGGAC pLX_317 55% 21.5% 22.4% V5 (many diffs) n/a
Download CSV