Construct: ORF TRCN0000466368
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013210.1_s317c1
- Derived from:
- ccsbBroadEn_09925
- DNA Barcode:
- GCCCGCTCTGTAGTCCCCTGTTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TAS2R43 (259289)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466368
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | NM_176884.2 | 99.6% | 99.3% | 104G>C;635A>G;663C>G |
| 2 | human | 259290 | TAS2R31 | taste 2 receptor member 31 | NM_176885.2 | 94.3% | 88.9% | (many diffs) |
| 3 | human | 259292 | TAS2R46 | taste 2 receptor member 46 | NM_176887.2 | 93% | 87.3% | (many diffs) |
| 4 | human | 259291 | TAS2R45 | taste 2 receptor member 45 | NM_176886.2 | 89.3% | 82.5% | (many diffs) |
| 5 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | XM_003960991.5 | 89.3% | 82.5% | (many diffs) |
| 6 | human | 259293 | TAS2R30 | taste 2 receptor member 30 | NM_001097643.1 | 88.6% | 77.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 996
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gataactttt ctacccatca ttttttccag tctggtagtg gttacatttg 121 ttattggaaa ttttgctaat ggcttcatag cactggtaaa ttccattgag tcgttcaaga 181 gacaaaagat ctcctttgct gaccaaattc tcactgctct ggcggtctcc agagttggtt 241 tgctctgggt attattatta aactggtatt caactgtgtt gaatccagct tttaatagtg 301 tagaagtaag aactactgct tataatatct gggcagtgat caaccatttc agcaactggc 361 ttgctactac cctcagcata ttttatttgc tcaagattgc caatttctcc aactttattt 421 ttcttcactt aaagaggaga gttaagagtg tcattctggt gatgttgttg gggcctttgc 481 tatttttggc ttgtcatctt tttgtgataa acatgaatga gattgtgcgg acaaaagaat 541 ttgaaggaaa catgacttgg aagatcaaat tgaagagtgc aatgtacttt tcaaatatga 601 ctgtaaccat ggtagcaaac ttagtaccct tcactctgac cctactatct tttatgctgt 661 taatctgttc tttgtgtaaa catctcaaga agatgcagct ccgtggtaaa ggatctcaag 721 atccCAGCAC GAAGGTCCAC ATAAAAGCTT TGCAAACTGT GATCTCCTTC CTCTTGTTAT 781 GTGCCATTTA CTTTCTGTCC ATAATGATAT CAGTTTGGAG TTTTGGAAGT CTGGAAAACA 841 AACCTGTCTT CATGTTCTGC AAAGCTATTA GATTCAGCTA TCCTTCAATC CACCCATTCA 901 TCCTGATTTG GGGAAACAAG AAGCTAAAGC AGACTTTTCT TTCAGTTTTT TGGCAAATGA 961 GGTACTGGGT GAAAGGAGAG AAGACTTCAT CTCCATTGCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 AGCCCGCTCT GTAGTCCCCT GTTCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt