Transcript: Human NM_176887.2

Homo sapiens taste 2 receptor member 46 (TAS2R46), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TAS2R46 (259292)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_176887.2
NBCI Gene record:
TAS2R46 (259292)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431161 TTTACTCTGGGTATTAGTATT pLKO_005 171 CDS 100% 13.200 9.240 N TAS2R46 n/a
2 TRCN0000426878 ACGGTAACCATCCTAGCAAAC pLKO_005 532 CDS 100% 6.000 4.200 N TAS2R46 n/a
3 TRCN0000424994 TGTCCATAATCATGTCAGTTT pLKO_005 728 CDS 100% 4.950 3.465 N TAS2R46 n/a
4 TRCN0000014109 ACCTTTCAAATACAACGGTAA pLKO.1 518 CDS 100% 4.050 2.835 N TAS2R46 n/a
5 TRCN0000014110 CCATTCTAATAGTGGTTACAT pLKO.1 29 CDS 100% 5.625 3.375 N TAS2R46 n/a
6 TRCN0000014111 GCTTACAATGTCTGGGCAGTA pLKO.1 250 CDS 100% 4.050 2.430 N TAS2R46 n/a
7 TRCN0000414049 CCAATTTCTCCAACCTTATTT pLKO_005 332 CDS 100% 15.000 7.500 Y TAS2R31 n/a
8 TRCN0000419049 GCTACTAGCCTCAGCATATTT pLKO_005 295 CDS 100% 15.000 7.500 Y TAS2R31 n/a
9 TRCN0000014112 CCTCTTGTTATGTGCCATTTA pLKO.1 702 CDS 100% 13.200 6.600 Y TAS2R46 n/a
10 TRCN0000014108 GCCATTTACTTTCTGTCCATA pLKO.1 715 CDS 100% 4.950 2.475 Y TAS2R46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09925 pDONR223 100% 93% 87.3% None (many diffs) n/a
2 ccsbBroad304_09925 pLX_304 0% 93% 87.3% V5 (many diffs) n/a
3 TRCN0000466368 GCCCGCTCTGTAGTCCCCTGTTCG pLX_317 29.6% 93% 87.3% V5 (many diffs) n/a
4 TRCN0000489249 CCGCACTCCATTGCACTACACTAG pLX_317 38% 93% 87.3% V5 (many diffs) n/a
5 TRCN0000489520 TATAGCGGGATGGACCCCGAGCCC pLX_317 38.3% 93% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_05327 pDONR223 100% 92.4% 85.1% None (many diffs) n/a
7 ccsbBroad304_05327 pLX_304 0% 92.4% 85.1% V5 (many diffs) n/a
8 TRCN0000468403 ACTGTGGCGTAATCGCCCACATCG pLX_317 34.3% 92.4% 85.1% V5 (many diffs) n/a
9 TRCN0000489084 TTTAACCCATGTCCATTTAATTGG pLX_317 38% 92.4% 85.1% V5 (many diffs) n/a
10 TRCN0000489803 CCCATGGAGTTTCCAGTACTACTA pLX_317 42.5% 92.4% 85.1% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000492003 TCCAAATTGCACGTCTGAAATGTA pLX_317 42.1% 89.2% 82.8% V5 (many diffs) n/a
12 TRCN0000489145 CCAGCATCAAGAGTGATCTTGGCG pLX_317 42.4% 89.2% 82.8% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_14457 pDONR223 100% 89.1% 82.2% None (many diffs) n/a
14 ccsbBroad304_14457 pLX_304 0% 89.1% 82.2% V5 (not translated due to frame shift) (many diffs) n/a
15 TRCN0000473180 AGAATGGATGTTCGATCTTTTATC pLX_317 42.3% 89.1% 82.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV