Construct: ORF TRCN0000466393
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012660.1_s317c1
- Derived from:
- ccsbBroadEn_03423
- DNA Barcode:
- AACCAAAGCCTGTCAGTGAGCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIMREG (54478)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466393
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54478 | PIMREG | PICALM interacting mitotic ... | NM_019013.3 | 100% | 100% | |
| 2 | human | 54478 | PIMREG | PICALM interacting mitotic ... | NM_001195228.2 | 94.1% | 92.7% | (many diffs) |
| 3 | human | 54478 | PIMREG | PICALM interacting mitotic ... | XM_017024778.1 | 68.1% | 58.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 780
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ttctcggtgg cagaacatgg ggacctccgt gcgccggaga tctctccagc 121 accaggagca gctggaggac agcaaggagc tgcagcctgt ggtcagccat caggagacct 181 ctgtaggggc cctggggtcc ctgtgcagac agttccaaag gaggctgccc ctgagagccg 241 tcaacctcaa cctccgcgca gggccctcct ggaaacgcct ggaaacccca gagccaggtc 301 agcagggcct ccaggctgca gctcgctcag ctaagagtgc tttgggtgcc gtgtcccaga 361 gaatccagga gtcctgccaa agtggcacca agtggctggt ggagacccag gtgaaggcca 421 ggaggcggaa gagaggagca cagaagggca gtggatcccc aactcacagc ctgagccaga 481 agagcacccg gctgtctGGA GCCGCCCCTG CCCACTCAGC CGCAGACCCC TGGGAGAAGG 541 AGCATCACCG CCTCTCTGTC CGGATGGGCT CACATGCCCA CCCATTACGG CGATCAAGGC 601 GGGAGGCTGC CTTCCGGAGC CCCTACTCCT CAACAGAGCC CCTCTGCTCT CCCAGCGAGT 661 CTGACAGTGA CCTAGAGCCT GTGGGGGCGG GAATTCAGCA TCTCCAGAAG CTGTCCCAAG 721 AGCTAGATGA AGCCATTATG GCGGAAGAGA GTGGTGACAT CGTCTCTCTC ATTCATGACT 781 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 841 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 901 TTTATATATC TTGTGGAAAG GACGAAACCA AAGCCTGTCA GTGAGCACCA CGCGTTAAGT 961 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt