Transcript: Human NM_001195228.2

Homo sapiens PICALM interacting mitotic regulator (PIMREG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PIMREG (54478)
Length:
1863
CDS:
70..816

Additional Resources:

NCBI RefSeq record:
NM_001195228.2
NBCI Gene record:
PIMREG (54478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431747 AGTGCTAGCATCAGATATTTG pLKO_005 1073 3UTR 100% 13.200 18.480 N PIMREG n/a
2 TRCN0000421871 TGACCTTGAGCCTTCTATTTG pLKO_005 1035 3UTR 100% 13.200 18.480 N PIMREG n/a
3 TRCN0000062590 TCGCTCAGCTAAGAGTGCTTT pLKO.1 327 CDS 100% 4.950 6.930 N PIMREG n/a
4 TRCN0000062588 CCCACCCATTACGGCGATCAA pLKO.1 581 CDS 100% 1.650 2.310 N PIMREG n/a
5 TRCN0000062589 CTGTCCCAAGAGCTAGATGAA pLKO.1 715 CDS 100% 4.950 3.465 N PIMREG n/a
6 TRCN0000062591 CCTGCCAAAGTGGCACCAAGT pLKO.1 377 CDS 100% 1.350 0.945 N PIMREG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03422 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03422 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466411 TATATTGGGTATTTTGACCGTTTA pLX_317 45.6% 100% 100% V5 n/a
4 ccsbBroadEn_03423 pDONR223 100% 94.1% 92.7% None (many diffs) n/a
5 ccsbBroad304_03423 pLX_304 0% 94.1% 92.7% V5 (many diffs) n/a
6 TRCN0000466393 AACCAAAGCCTGTCAGTGAGCACC pLX_317 39.9% 94.1% 92.7% V5 (many diffs) n/a
Download CSV