Construct: ORF TRCN0000466485
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018147.2_s317c1
- Derived from:
- ccsbBroadEn_04920
- DNA Barcode:
- TAAAACAGTGGTCAGGCCGCTACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIP5KL1 (138429)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466485
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 138429 | PIP5KL1 | phosphatidylinositol-4-phos... | NM_173492.1 | 100% | 100% | |
| 2 | human | 138429 | PIP5KL1 | phosphatidylinositol-4-phos... | NM_001135219.2 | 48.4% | 48.4% | 1_609del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 639
- ORF length:
- 573
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gagcgtcttc taccccgccg gccgcatctc cgagaggtat gacatcaaag 121 gctgcgaggt gagccgctgg gtggatcccg cccctgaggg cagccccctt gttctggtgc 181 tgaaggacct caactttcag ggcaagacca tcaacctggg gccccagcgg agctggttcc 241 tccgccagat ggaactggat accaccttcc tccgggagct caacgtgctg gattacagcc 301 tcctgatagc cttccaacgt ctccacgagg atgagagggg cccgggcagc agcctcatct 361 tccgcacggc caggtctgtg caaggggcac agagcccgga agagtcgaga gcccaaaacc 421 gccggctgct gcCCGACGCC CCCAACGCCC TACACATCCT GGACGGGCCC GAGCAGCGCT 481 ATTTCCTGGG CGTCGTGGAT CTCGCCACAG TCTACGGGCT CCGCAAGCGG CTGGAGCACC 541 TGTGGAAGAC ACTGCGCTAC CCAGGCCGGA CCTTCTCCAC TGTCAGCCCG GCTCGCTACG 601 CCCGTCGCCT CTGCCAGTGG GTGGAGGCGC ACACGGAGTG CCCAACTTTC TTGTACAAAG 661 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 721 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 781 ACGATAAAAC AGTGGTCAGG CCGCTACTAC GCGTTAAGTC gacaatcaac ctctggatta 841 caaaatttgt gaaagatt